Гост для оформления реферата: К сожалению, что-то пошло не так

Содержание

ГОСТ оформление рефератов 2020, 2021

Содержание

  1. Общие правила
  2. Титульный лист
  3. Содержание
  4. Введение, основанная часть, заключение
  5. Литература

Чтобы защитить научную работу, ее нужно не только качественно написать, но и надлежащим образом оформить. Последнее является не менее важным фактором при оценивании труда учащегося, нежели само проведенное исследование. В равной мере это относится и к реферату – наиболее простому формату научно-исследовательской работы. Тем не менее, правила оформления реферативного исследования относительно свободны, в том смысле, что предоставляют выбор между несколькими вариантами оформления.

Таких вариантов существует три – государственный стандарт, нормативы учебного заведения и особые правила, выдвигаемые преподавателем, под чьим руководством пишется работа. Разумеется, в первую очередь нужно ориентироваться на требования последнего, так как именно от него будет зависеть оценка работы.

Если же преподавателем не выдвинуто специфических правил, то следует обратиться к методичке по оформлению научных работ из отдела методологии учебного заведения.

Бывают, однако, такие обстоятельства, когда методички нет или учащемуся предоставлена свобода в выборе стандартов оформления. В данном случае целесообразным представляется обратиться к общепринятым государственным стандартам, отраженным в нижеследующих рекомендациях и примерах.

Общие правила

Общие требования ГОСТа требуют, чтобы текст работы был напечатан на белой бумаге формата А4 черным цветом. Преимущественный шрифт – Times New Roman. Кегль текста – 14 пт. Межстрочный интервал, за исключением титульного листа, полуторный. При редактировании титульника чаще всего применяется одинарный интервал.

Требования к полям реферата стандартные – по 15 мм. для верхней и правой границ, 25 мм. для левой и для нижней 30 мм.

Что до нумерации, то она осуществляется арабскими цифрами и включает в себя все страницы работы. Первая и вторая страницы, то есть титульный лист и содержание – не подлежат простановке цифр порядкового номера, но в нумерацию включены. Таким образом, нумерация начинается с цифры «3» на третьей странице с введением.

Титульный лист

Титульник оформляется по индивидуальным правилам – он больше всех отличается от других элементов реферата. Его цель – обеспечить читателя информацией об авторе исследования, теме и рядом других, менее важных, сведений.

Схематично можно описать титульный лист, как элемент, состоящий из четырех отдельных блоков. Первый блок располагается в самом верху. Второй по центру. Третий в нижней части страницы справа. А четвертый – в самом низу. Все они, за исключением третьего, имеют выравнивание по центру строки. При этом одни их части могут выделяться прописными буквами.

Первый блок включает в себя название ВУЗа (или иного учебного заведения), которое пишется на первой строчке прописными буквами. Если работа выполняется в университете или техникуме, то далее следует отступ в одну строку, после чего следует название факультета, а еще строкой ниже – кафедры.

Вот образец первого блока:

 

Министерство образования и науки Российской Федерации

НЕГОСУДАРСТВЕННОЕ НАУЧНО-ОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ

ВЫСШЕГО ПРОФЕССИОНАЛЬНОГО ОБРАЗОВАНИЯ

«УНИВЕРСИТЕТ

Ν»

 

Факультет Ν

Кафедра Ν

 

Ниже первого блока, в самой середине страницы, находится второй блок. Его содержание – полное название темы работы, научной дисциплины, по которой она выполняется и типа исследования. В нашем случае это реферат. При этом тип пишется заглавными буквами.  

Образец второго блока:

 

РЕФЕРАТ

по дисциплине

«Ν»

на тему

«Ν»

 

Третий блок, как было сказано выше, локализуется в правой части страницы. Он состоит из фамилий и инициалов автора работы и научного руководителя, а также из их сопутствующих данных – номера группы, отделения, должности и регалий.

Образец третьего блока:

 

 

Выполнила:

студентка Ν курса

дневного (вечернего, заочного) отделения
группы № XX-XX

Иванова И. И.

 

Научный руководитель:
к-т наук, профессор
Иванов И. И.

 

Последний в этом списке блок – нижний. Он самый маленький по объему – в него входят только год написания работы и город. Форматируется он по следующему образцу:

 

Город

Год

 

Содержание

Вторая страница реферата – его содержание, которое должно состоять из перечня всех структурных элементов, кроме титульника и самого содержания. К ним указываются страницы в тексте.

Форматируется оно в соответствии со следующим образцом (обратите внимание на выделение прописью заголовка):

 

СОДЕРЖАНИЕ

                                                                                                                              стр.

Введение                                                                                                           3

Глава 1. Ν                                                                                                           3                         

Глава 2. Ν                                                                                                           6

Глава 3. Ν                                                                                                          11

Заключение                                                                                                    13

Список использованной литературы                                                14

Введение, основанная часть, заключение

Три составные части самого текста работы подчиняются общим стандартам форматирования текста. Оформление их заголовков производится аналогично содержанию.

Литература

Раздел с литературой формируется в виде нумерованного списка не менее чем из пяти пунктов. Каждый источник оформляется в соответствии с правилами библиографического описания. Принцип последовательности для реферата – алфавитный. При этом важно помнить, что сначала следует указать литературные источники, а уже затем все остальные.

 

Оформление реферата по ГОСТу 2019

Для оформления работ научно-исследовательского характера, в категорию которых входит реферат, применяются требования современных стандартов. К оформлению реферата на 2019 учебный год предусмотрены стандарты ГОСТ в отношении структуры текста и его содержания. Грамотно написать реферат помогут рекомендации преподавателя, правила, указанные в методическом пособии и стандарты ГОСТ.

Порядок оформления реферата 2019

Первое, с чего начинают оформление реферата, это титульный лист. Внешний вид титульного листа формирует у преподавателя первое впечатление о работе – насколько добросовестно и качественно она выполнена. Содержание титульного листа состоит из данных об учебном заведении, которые указываются в правом верхнем углу листа, названия темы – оформляется по центру страницы и данных автора.

Имя и фамилия автора, его факультет, специальность и номер группы указывается в правом углу нижней части страницы, также здесь указывается имя и фамилия научного руководителя.

После оформления титульного листа приступают к содержанию реферата. Оформление внутренней структуры реферата состоит из содержания, состоящего из перечисления глав:

– введения;

– основной части;

– заключительной части;

– выводов;

– библиографии;

– приложения.

Далее, каждая глава оформляется отдельно с чистой страницы и названия, оформленного заглавными буквами. К рефератам 2019 предусмотрен ГОСТ в отношении шрифта – черный цвет, стиль Times New Roman высотой не более 14 кегель с полуторным интервалом. А также к объему работы – не менее 25-30 страниц печатного текста, которые необходимо пронумеровать с помощью арабских цифр. Печатный текст размещается на странице с соблюдением отступов – с левой стороны 3 см для подшивки работы и по 1,5 см от остальных сторон.

Подробнее о том как оформить рефрат по ГОСТу смотрите видео ниже.

Письменное содержание текста необходимо составить в деловом стиле, поскольку это научно-исследовательская работа, а не простое повествование. Деловой стиль написания подразумевает наличие достоверных фактов, использование цитат, научных формулировок и специальной терминологии. Содержание реферата – это последовательное и логически обоснованное изложение информации, а для этого нужно, всего лишь, придерживаться плана работы. Оглавление реферата, это и есть последовательный план работ.

Важность оформления

Каждая научная работа должна быть оформлена в соответствии с правилами ГОСТ. Правила стандартизации введены с целью создания единой системы для выполнения научных работ в разной области специализации.

Таким образом, придерживаясь строго плана и правил оформления, выполнить научную работу будет намного легче и проще, независимо от ее темы и области науки. Для тех, у кого возникли сложности с выполнением реферата, курсовой работы или диплома, специалисты нашего сервиса предлагают свои услуги. С помощью наших услуг ваши работы будут выполнены качественно, недорого и главное в срок!

Оформление реферата образец 2021 / 2022

Все пишут рефераты но немногие знают как правильно оформить титульный лист, содержание и список источников. Именно на эту тему пойдет речь в данной публикации

Реферат – это самый начальный (примитивный) уровень исследовательских работ, содержание которых характеризуется малым размером, в нем нету практического раздела и предельно простые требования к оформлению. Написанием реферата занимаются не только студенты. Рефераты задают и школьникам. И все они должны быть выдержаны в едином стиле оформления, основные элементы оформления такие же, как и у более сложных научно-прикладных работ. Не нужно думать, что оформление реферата не влияет на оценку. Преподаватель в любом случае отдаст вам на доработку этот проект, если нарушены правила оформления. Поэтому важно соблюдать изначально все каноны внешнего вида реферата. Несмотря на наличие общего стандарта оформления, каждое учебное заведение (независимо от уровня) могут вносить свои отличия в эти стандарты. Поэтому придерживайтесь слову стандарта, только если у вас нету иных рекомендаций (отдела методологии ВУЗа или преподавателя).

Исходя из общих критериев, реферат пишется на чистом листе формата А4. Шрифт Times New Roman не прописан в ГОСТе, но его использование уже стало стандартом. Необходимый кегль 12 или 14. Проставьте галочку на полуторном междустрочном интервале. Верхние и правые поля определяются значением 1,5 см. Левое поле несколько больше – 2,5 см. Нижнее поле 3,0 см.

Не забывайте пронумеровать страницы, за исключением титульного листа и содержания. На страницы введения проставьте цифру «3».

Оформление титульного листа реферата: образец 2021 / 2022.


На самой первой странице содержится информация о учебном заведении и теме реферата. Так же указаны данные о преподавателе и авторе.

Министерство образования и науки Российской Федерации

ГОСУДАРСТВЕННОЕ НАУЧНО-ОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ

СРЕДНЕГО ПРОФЕССИОНАЛЬНОГО ОБРАЗОВАНИЯ

«БЛАГОВЕЩЕНСКИЙ ТОРГОВО-ЭКОНОМИЧЕСКИЙ ТЕХНИКУМ»

 

Факультет гуманитарных наук

 

 

РЕФЕРАТ

по дисциплине «Туроператорская деятельность»

на тему «Особенности работы туроператоров и турагентов»»

 

 

Выполнил:

студент 2 курса

отделение 25
группа СТ – 21
Межкомов Д. С

Научный руководитель:
ст. преподаватель
Голобородько Д.Н.

 

 

Благовещенск

2021

 

Оформление содержания реферата: образец 2021 / 2022г.


Следующим по структуре идет содержание. Содержание можно сопоставить с планом вашей работы. В нем необходимо прописать все заголовки и подзаголовки реферата, все полные названия разделов, список литературы и прочее. Не забудьте проставить номер страницы напротив каждого пункта.

Содержание
Введение …………………………………………………………………………………………………….. 2

1. Наименование первой главы: …………………………………………………………………….5

1.1 Наименование параграфа №1 …………………………………………………………. ………5

1.2 Наименование параграфа №2 ………………………………………………………………… 10

  1. Название второй главы: …………………………………………………………………………… 15

2.1 Наименование параграфа №1 ………………………………………………………………… 15

2.2 Наименование параграфа №2…………………………………………………………………. 21

Заключение ……………………………………………………………………………………………….. 27

Список  используемой литературы (источников информации) …………………….. 28

Приложения (при их наличии): ………………………………………………………………….. 29

 

Основная часть

В основной части учащиеся раскрывают цель и задачи своей работы. Здесь описываются анализ и исследование темы, поиск методов решения проблемы, прописывается решение проблемы. Реферат состоит из нескольких основных глав, в которых расписываются несколько подразделов. Основная часть начинается с введения, а заканчивается заключением. Каждая часть реферата начинается с чистого листа. Названия разделов пишутся в центре строки большими буквами, возможен жирный шрифт.

Оформление списка литературы в реферате.

В списке литературы правила оформления просты: проставляется нумерация арабскими цифрами и в алфавитном порядке перечисляются источники. Минимальное количество источников – 5, сперва указываются литературные источники, затем периодика, а в заключение интернет-ресурсы.

Список литературы

  1. Атаманчук, Г. В. Сущность государственной службы: История, теория, закон, практика / Г. В. Атаманчук. – М.: РАГС, 2003. – 268 с.

       2, Игнатов, В. Г. Профессиональная культура и профессионализм государственной службы: контекст истории и современность / В. Г. Игнатов, В. К. Белолипецкий. – Ростов-на-Дону: МарТ, 2000. – 252 с.

Как видите правила совсем несложные. Уже после первых работ они войдут в привычку, и вы не будете переживать о правильности оформления.

Page 17 | Правила оформления реферата, доклада, выпускной квалификационной работы

Страница 17 из 26

 

Требования к содержанию структурных элементов пояснительной записки

Титульный лист

Титульный лист является первой страницей работы и служит источником информации, необходимой для обработки и поиска документа.

На титульном листе приводятся сведения о наименовании организации, наименовании работы, исполнителе, месте и дате выполнения работы. Если работа состоит из двух и более частей, то каждая часть должна иметь свой титульный лист, соответствующий титульному листу первой части и содержащий сведения, относящиеся к данной части.

Титульный лист работы следует оформлять в соответствии с приведенными ранее примерами.

Реферат

Общие требования к реферату на работу – по ГОСТ 7.9-95.

Реферат должен содержать:

  • сведения об объеме работы, количестве иллюстраций, таблиц, приложений, количестве частей работы, количестве использованных источников;
  • перечень ключевых слов;
  • текст реферата.

Перечень ключевых слов должен включать от 5 до 15 слов или словосочетаний из текста работы, которые в наибольшей мере характеризуют его содержание и обеспечивают возможность информационного поиска. Ключевые слова приводятся в именительном падеже и печатаются строчными буквами в строку через запятые.

Текст реферата должен отражать:

  • объект исследования или разработки;
  • цель работы;
  • результаты работы;
  • степень внедрения;
  • рекомендации по внедрению или итоги внедрения результатов работы;
  • область применения;
  • экономическую эффективность или значимость работы.

Если работа не содержит сведений по какой-либо из перечисленных структурных частей реферата, то в тексте реферата она опускается, при этом последовательность изложения сохраняется.

Пример составления реферата приведен в приложении В.

Содержание

Содержание включает введение, наименование всех разделов, подразделов, пунктов (если они имеют наименование), заключение, список использованных источников и наименование приложений с указанием номеров страниц, с которых начинаются эти элементы работы.

При составлении работы, состоящей их двух и более частей, в каждой из них должно быть свое содержание. При этом в первой части помещают содержание всей работы с указанием номеров частей, в последующих – только содержание соответствующей части. Допускается в первой части вместо содержания последующих частей указывать только их наименования.

В работе объемом не более 10 страниц содержание допускается не составлять (приложение В).

Введение

Введение должно содержать оценку современного состояния решаемой проблемы, основание и исходные данные для разработки темы, обоснование необходимости проведения работы. Во введении должны быть показаны актуальность и новизна темы (приложение В).

Основная часть

В основной части работы приводят данные, отражающие сущность, методику и основные результаты выполнения работы.

Основная часть должна содержать:

  • сведения о патентных исследованиях и обзор научно-технической литературы по изучаемому вопросу и выводы из них;
  • выбор направления исследований, включающий обоснование направления исследования, методы решения задач и их сравнительную оценку, описание выбранной методики проведения работы;
  • описание теоретических и (или) экспериментальных исследований, включая определение характера и содержания теоретических исследований, методов исследований, методы расчета, обоснование необходимости проведения экспериментальных работ, принцип действия разработанных объектов, их характеристику;
  • обобщение и оценку результатов исследований, включающих оценку полноты решения поставленной задачи и предложения по дальнейшим направлениям работ, оценку достоверности полученных результатов и их сравнение с аналогичными результатами других работ, отрицательные результаты и т. д.

Представление в работе данных о свойствах веществ и материалов проводятся по ГОСТ 7.54, единицы физических величин – по ГОСТ 8.417.

Заключение

Заключение должна содержать:

  • краткие выводы по результатам выполнения работы или отдельных ее этапов;
  • оценку полноты решения поставленных задач;
  • разработку рекомендаций по конкретному использованию результатов работы;
  • оценку технико-экономической эффективности внедрения. Пример в приложении В.

Список использованных источников

Список должен содержать сведения об источниках, использованных при разработке работы. Сведения об источниках приводятся в соответствии с требованиями ГОСТ 7.1. Пример приведен в приложении В.

Приложения

В приложения рекомендуется включать материалы, связанные с выполненной работой, которые по каким-либо причинам не могут быть включены в основную часть. В приложения могут быть включены:

  • промежуточные математические доказательства, формулы и расчеты;
  • таблицы вспомогательных цифровых данных;
  • протоколы испытаний;
  • описание аппаратуры и приборов, применяемых при проведении экспериментов, измерений и испытаний;
  • заключение метрологической экспертизы;
  • инструкции, методики, разработанные в процессе выполнения работы;
  • иллюстрации вспомогательного характера;
  • программы работ;
  • акты внедрения результатов НИР и др.

В приложения к работе, в составе которой предусмотрено проведение патентных исследований, должен быть включен отчет о патентных исследованиях, оформленный по ГОСТ Р 15.011-96, библиографический список публикаций и патентных документов, полученных в результате выполнения работы, — по ГОСТ 7.1.

 



Оформление титульного листа реферата по ГОСТ

Современный мир довольно жесток, особенно по отношению к молодежи: каждый стремится быть лучшим из всех и занять свое место под солнцем. Мало кому нравится проигрывать, у каждого свои амбиции, каждый хочет получить много материальных благ практически сразу, а не копить их годами. Поэтому самые нетерпеливые и амбициозные стремятся получить как минимум два высших образования, чтобы иметь возможность трудоустроиться хотя бы по одной из полученных специальностей.

Но что за учеба без написания всевозможных рефератов? Однако следует отметить, что даже если само произведение написано красиво, его можно вернуть на доработку только потому, что титульный лист оформлен неправильно. Поэтому, чтобы избежать такой ситуации, мы рассмотрим некоторые особенности, которые следует учитывать при выполнении реферата. Титульный лист для него, как и любой другой вид учебной работы или документа, должен быть написан без отклонения от принятых государством правил и норм или, проще говоря, ГОСТа.

Выделим самые основные правила, которые могли бы помочь максимально правильно оформить главную страницу вашей самостоятельной работы. Первая страница – это «лицо» эссе, поэтому в ней не должно быть недостатков. Поэтому правило номер один: вся информация об этой работе должна быть указана в строго определенном порядке. Дизайн титульного листа аннотации должен начинаться с размещения вверху (и в центре) полного названия вашего учреждения. Сразу под ним так же нужно указать его структурное подразделение (кафедру, факультет).Немного отступив (но по-прежнему по центру), укажите тип учебной работы (в данном случае – аннотация). Следующая строка – название учебной дисциплины, по которой написана работа. Очень многие студенты совершают ту же ошибку: они помещают тему реферата в кавычки, а перед названием ставят слово «тема». В этом нет необходимости, так как оформление титульного листа аннотации по ГОСТу не требует таких обозначений.

Далее вы должны предоставить информацию о человеке, написавшем произведение, то есть о вас.Поэтому нужно немного отступить от темы и, сделав правильное выравнивание, указать свой курс, номер группы и полное имя. Еще ниже написана информация о научном руководителе, задававшем эту работу. Правильное оформление титульного листа реферата предполагает следующий порядок введения сведений об учителе: его фамилию, имя и отчество, а затем – ученую степень и звание. В самом низу листа и снова в центре указывается город, в котором выполнялась работа, и год ее завершения.В этом случае слово «год» писать не нужно, ставятся только цифры.

А теперь несколько слов о полях, границах и других деталях. Обратите внимание, что нижнее и верхнее поля титульного листа должны быть одинаковой ширины и составлять 30 мм. При написании названия школы, а также темы сочинения все буквы должны быть заглавными. От названия листа (место, где указано название стула) до названия темы обязательно соблюдайте расстояние – оно должно быть не менее 80 мм.И небольшое примечание: выполняя оформление титульного листа аннотации, не совершите грубую ошибку – поставив номер на этой странице. Да, он считается первым, но нумеровать его ни в коем случае не нужно.

Вот, пожалуй, самые основные требования, которые необходимо соблюдать при грамотном оформлении работы. Если вы будете следовать им в будущем, ваши научные руководители не смогут это игнорировать. Будьте уверены, что правильный макет титульного листа эссе – это почти половина успеха вашей работы, оценка никогда не будет снижена, а сама страница не пойдет на доработку.

p>

Нью-Йорк DMV | Получить регистрацию транспортного средства или запись о праве собственности (аннотация)

Выдержки из регистрационных записей транспортных средств и правового титула представляют собой сводки

Выдержки из регистрационных записей и документов о праве собственности представляют собой резюме регистрационных (табличных) и титульных записей. Они не являются действительными регистрационными или правоустанавливающими документами. Для получения дополнительной информации см. Определения регистрации транспортных средств и выписки из записи о праве собственности, выпущенные Управлением по делам транспорта Нью-Йорка.

Если вам нужна новая копия регистрации транспортного средства, см. Как заменить регистрацию.

Если вам нужна копия свидетельства о праве собственности на автомобиль, см. Как заменить свидетельство о праве собственности.

Как получить выписку о регистрации транспортного средства

Вы можете заказать выписку о регистрации транспортного средства, используя форму Request for DMV Records (PDF) (MV-15).

Включите эти элементы в свой запрос

  • ваш номерной знак или идентификационный номер транспортного средства (VIN)
    • если вы не знаете свой номерной знак или VIN, укажите свое имя и дату рождения (DOB), а также марка транспортного средства и год выпуска
  • ксерокопия ваших водительских прав или другого государственного удостоверения личности с фотографией в качестве подтверждения личности
  • личный чек или денежный перевод (выплачивается «Комиссариату по автотранспортным средствам») для уплаты сбора за поиск в размере 10 долларов.00

Отправьте письмо по адресу, указанному в форме.

Как получить реферат для записи о праве на транспортное средство

Вы можете заказать реферат для записи о праве собственности, используя форму Request for DMV Records (PDF) (MV-15).

Включите эти элементы в свой запрос

  • Идентификационный номер транспортного средства (VIN)
    • , если вы не знаете VIN, мы можем найти запись, используя наши регистрационные файлы – укажите имя и дату рождения ( DOB) регистранта, а также год и сделайте для транспортного средства
  • ксерокопию вашего водительского удостоверения или другого государственного удостоверения личности с фотографией в качестве подтверждения личности
  • , личный чек или денежный перевод (выплачивается уполномоченному Автомобили ») уплатить пошлину за поиск в размере 10 долларов США.00

Отправьте письмо по адресу, указанному в форме.


Как получить записи другого лица

Вы должны отправить запрос на записи DMV (PDF) (MV-15) и подтвердить, что у вас есть допустимое использование в соответствии с Законом о защите конфиденциальности водителя (DPPA), чтобы увидеть личные данные. информация о другом человеке в записях DMV. См. Дополнительную информацию в Законе о защите конфиденциальности водителей (DPPA).

Рекомендации по регистрации и тезисам – Sigma XI

Добро пожаловать на страницу регистрации на исследовательский симпозиум SJU Sigma Xi 2021 года, который будет проходить онлайн через Zoom в пятница, 23 апреля 2021 г., с 17:00.м. до 21:00

Регистрация на исследовательский симпозиум 2021 года уже открыта и будет закрыта в 17:00. 21 апреля 2021 г.

Вы должны сначала зарегистрироваться для участия в симпозиуме, после чего вы получите номер заказа, который будет необходим для подачи вашего тезиса.

ПРОЧИТАЙТЕ «Правила подачи тезисов» перед загрузкой файла тезисов.

Руководство по подаче тезисов

  • Тезисы должны быть представлены в виде документов Microsoft Word (в формате «.doc »файл).
  • Текст должен быть шрифтом Times размером 12 пт.
  • Тезисы не должны превышать 300 слов.
  • Тезисы ограничены одной страницей с полями в 1 дюйм.

Пожалуйста, следуйте инструкциям ниже для заголовков:

Первая строка – Название, ЖИРНЫМ шрифтом и ЗАГЛАВНЫМИ БУКВАМИ
Вторая строка – Фамилия автора, первая буква (за которой следует звездочка). Наставник (и) факультета фамилия, первые инициалы (необходимо подчеркнуть)
Третья строка – ведомственная принадлежность
Четвертая строка – название школы
Пятая строка – город, штат и почтовый индекс школы (если несколько участвуют колледжи / университеты и / или факультеты, перечислите каждый с его адресом.Цифры в надстрочном индексе могут использоваться для обозначения авторов из каких учреждений).

Пожалуйста, оставьте одну пустую строку между заголовком и основной частью тезисов, которая должна быть через один интервал и выровнена по ширине.

Пример: (Используйте одиночный пробел, как показано ниже.)

РОЛЬ ХЛОРА В ОБЕЗЗАРАЖИВАНИИ ПИТЬЕВОЙ ВОДЫ .
Смит, А. *, Джонсон, Б. и Джонс, Д.
Технический факультет
Городской университет
Филадельфия, Пенсильвания 19000

Sigma Xi не несет ответственности за отсутствие информации в загруженных тезисах.Если у вас есть какие-либо вопросы о подаче тезисов, пожалуйста, свяжитесь с доктором Шааном Бхаттом по телефону 610-660-3440 или [email protected]

Авторам – Вестник Казанского государственного аграрного университета

Предоставленная к публикации статья должна содержать результаты научных исследований в области экономики сельского хозяйства, механизации и технических услуг, сельского хозяйства, ветеринарии и зоотехники, лесного хозяйства и экологии. Статьи отбираются по критерию актуальности и новизны рассматриваемых научных проблем.
Объем публикаций, включая вложения, не должен превышать 10 страниц статей, а проблемный характер 6 страниц – для сообщений по тем или иным вопросам. Статьи должны быть напечатаны на листах формата А4, шрифт – Times New Roman, размер – 14 пт, межстрочный интервал – 1,5. Поля вверху и внизу – по 2 см, справа и слева – по 3 см, абзацу – 1 см (не спрашивайте пробелы) формат – книга.
Если статья была или будет отправлена ​​в другое издание, необходимо сообщить об этом в редакцию.

Изготовление изделия.
Слева в правом верхнем углу без абзаца напечатана статья УДК (УДК проверяет правильность выбранного сайта для Всероссийского института научной и технической информации – ВИНИТИ).
Внизу, через пробел в центральной строке заголовок (заголовок статьи должен отражать основную идею выполненного исследования, чтобы быть как можно более кратким) жирными заглавными буквами на английском и русском языках с последующим пробелом в нижнем регистре – фамилия и инициалы автора. После этого пробел – аннотация на русском языке, с новым абзацем – ключевые слова (3-6), разделенные пробелами – аннотация на английском языке, с новым абзацем – ключевые слова на английском языке, через пробел – текст статьи.Объем тезисов – 1000-1200 знаков.
Язык английский или русский.
Таблицы предоставляются в Word и идентифицируя их порядковыми номерами (Таблица 1 и т. Д.) И названиями, параметрами, таблицами должны быть в книжном формате.
Формула – в стандартном редакторе формул Word, подтверждающих физическую сущность исследования (процесса), представлены без подробных математических преобразований. В конце в круглых скобках ставится номер, в скобках ставится количество формул в тексте.
Иллюстрации к статье (если есть) в стандартных графических форматах, обязательно с подписью (не более 4-х). Линейные схемы и рисунки в файле должны быть сгруппированы.
Библиографическая ссылка должна быть оформлена в соответствии с ГОСТ 7.0.5-2008 «Библиографическая ссылка» в виде единого списка с порядком цитирования в тексте ссылки с номером. Ссылка в текстовом формате в квадратных скобках. Библиография и БД переведены на английский язык (переводятся только названия статей, остальное – латиницей).

При написании научной статьи необходимо придерживаться следующей структуры изложения: «Введение», «Условия, материалы и методы исследования», «Анализ и обсуждение результатов», «Заключение».
В разделе «Введение» предлагается постановка задачи, должна быть сформулирована и обоснована цель работы и при необходимости рассмотрена ее связь с важными научными и практическими направлениями, дано теоретическое обоснование исследования. Должны быть связаны с последними публикациями, в том числе в сфере зарубежных авторов.
В следующем разделе раскрываются особенности данного исследования, приведены условия, материалы и методы.
Основной раздел статьи посвящен отчетности, анализу и обсуждению результатов. Полученные результаты следует рассматривать с точки зрения их научной новизны и сравнивать с соответствующими известными данными.
В заключение представлены выводы и рекомендации.

Представляют авторы (одновременно):
– Статья напечатанная без чернильных пятен на одной стороне стандартного листа, подписанная на последней странице всеми авторами.
– Статья в электронном виде, каждая позиция должна быть в отдельном файле. В названии файла фамилия первого автора.
– Сведения об авторе (в печатном и электронном виде): ФИО (полное), ученая степень, ученое звание, звание, полное наименование организации, номер телефона и адрес для связи, электронная почта; та же информация на английском.
– Отзыв с подписью (PhD) и печатью.
– Мнение о возможности публикации, оформленное в организации, от которой написана рукопись (сопроводительное письмо).
– Предоставлять свидетельство об окончании аспирантуры, подтверждающее место учебы.

При соблюдении формальных требований материалы для публикации предоставляются автором рукописи рецензируются, согласно установленному порядку рецензирования рукописей, поступающих в редакцию. Решение о принятии публикации после рецензирования редактором (заместителем редактора), а при необходимости – редакционной коллегией в целом. Автор не принимает к публикации редакционную коллегию рукописи, направив мотивированный отказ.
Взнос для аспирантов при публикации рукописей не взимается.

Статьи можно присылать по адресу: 420015, г. Казань, ул. Карла Маркса, 65, в редакцию журнала «Вестник Казанского государственного аграрного университета», или по электронной почте: Этот адрес электронной почты защищен от спам-ботов. У вас должен быть включен JavaScript для просмотра .

Анализ транскриптома и картирование связности Cissampelos pareira L. обеспечивает молекулярные связи модуляции ESR1 с вирусным ингибированием

Культура клеток и лечение Cipa

Cissampelos pareira L.Экстракт цельного растения был коммерчески получен в лиофилизированной форме от производителя, сертифицированного GMP. Неочищенные водные экстракты были реконструированы из порошка Cipa 30 . Свежие экстракты готовили непосредственно перед каждым экспериментом. Химическое профилирование экстракта проводили с помощью UPLC. Подробности описаны в дополнительных методах, а идентифицированные составляющие представлены в дополнительной таблице S2. Для последующих экспериментов следовали руководящим принципам, установленным CSIR, Индия.

Линия клеток

MCF7 (тройной положительный рак молочной железы) была получена от NCCS, Пуна.Его поддерживали в среде DMEM с высоким содержанием глюкозы, дополненной 10% FBS, 1 M HEPES и 1X антибиотиками-антимикотиками. Клетки содержали при 37 ° C и 5% CO 2 . MycoAlert (номер по каталогу LT07-318) использовался для тестирования культуры на микоплазму.

Клетки MCF7 обрабатывали 1 мкг, 10 мкг, 100 мкг, 500 мкг и 1000 мкг на мл водного экстракта из Cissampelos pareira L. Экстракт готовили вне кожуха для культивирования клеток, а затем фильтровали с использованием шприца 0,22 мкм. фильтр перед использованием в культуре клеток.Клетки MCF7 высевали при конфлюэнтности 60–70% 18–24 ч. до лечения. Клетки обрабатывали Cipa в течение 24 ч для каждого эксперимента. Для каждой серии экспериментов был приготовлен свежий экстракт.

Выделение РНК

и анализ полного транскриптома

Клетки MCF-7 высевали в 6-луночные планшеты при 60-65% конфлюэнтности и затем обрабатывали носителем, 1 мкг, 10 мкг, 100 мкг, 500 мкг и 1000 мкг Cipa в течение 24 дней. час Затем клетки обрабатывали трипсином и промывали PBS. Тотальную РНК выделяли с использованием TRIzol (Ambion, кат.15596026), и его целостность проверяли на 1% агарозном геле с последующим количественным определением Nanodrop (ND1000, Nanodrop Technologies, США). Полногеномные данные транскриптома были получены с использованием 250 мкг общей РНК для каждого образца в соответствии с протоколом производителя. Для этого эксперимента использовали картриджи GeneChip (Affymetrix) Human Transcriptome Array 2.0. Чип HTA 2.0 может захватывать 245 349 транскриптов, кодирующих белок, и 40 914 транскриптов, не кодирующих белок, в 64-формате.Вкратце, общую РНК получали с контролями поли А, и синтезировали кДНК первой цепи, а затем кДНК второй цепи. За этим следовала транскрипция in vitro с образованием кРНК, которую использовали в качестве матрицы для образования однонитевой кДНК или оц-кДНК. Наконец, оц-кДНК фрагментировали и пометили. На каждом этапе обеспечивалась очистка и количественный анализ образцов. Приблизительно 200 мкл образца, содержащего около 5,2 мкг меченой оц-кДНК, загружали в картриджи, которые затем хранили в печи для гибридизации Affymetrix, установленной на 45 ° C и 60 об / мин, в течение ночи.Картриджи были зарегистрированы на AGCC (Affymetrix GeneChip Command Console), а флюидика эксперимента (промывка и окрашивание) была проведена с использованием Affymetrix GeneChip Fluidics Station 450. Затем окрашенные чипы сканировали с помощью GeneChip Scanner 3000. Предварительные изображения были проверены на качество и Файлы .cell были созданы.

Сгенерированные файлы CEL были нормализованы по фону с использованием метода RMA. Пакетные эффекты были удалены, и дифференциальный анализ экспрессии генов был проведен с использованием пакета limma в R.После коррекции фона и нормализации RMA зонды, которые превышали значение p <0,05, были аннотированы и проанализированы на предмет дифференциальной экспрессии. Поскольку ни один зонд не мог квалифицировать отсечение при 1 мкг, 10 мкг и 100 мкг, дифференциальную экспрессию гена рассчитывали с использованием набора данных от 500 и 1000 мкг обработок с носителем, используемым в качестве контроля. Гены с абсолютным логарифмическим двукратным изменением ≥ 1 и значением p <0,001 были приняты как дифференциально экспрессируемые. Необработанные файлы и данные были отправлены в GEO под регистрационным номером GSE156445.

Синтез кДНК

и qPCR

КДНК

получали из 1 мкг РНК, обработанной ДНКазой, с использованием набора для обратной транскрипции кДНК Applied Biosystems High-Capacity cDNA (№ по каталогу 4368814) в соответствии с инструкциями производителя. RT-qPCR выполняли с использованием мастер-микса 2X SYBR Green I (Kapa Biosystems, каталожный номер KK3605), и реакцию проводили в Roche Light Cycler 480. GAPDH (FP: CGACCACTTTGTCAAGCTCA, RP: CTTCCTCTTGTATTTTTGCTG: , RP: AGAAAGTGGCTGAGGTTCTG) использовали в качестве нормализующих контролей.ESR1: (прямой праймер: CAAGGAGACTCGCTACTGT и обратный праймер: TTTCGTATCCCACCTTTCAT), RPL7: (прямой праймер: AAGCTCAACAAGGCTTCGAT и обратный праймер: CCAAGAGATCGAGCAATCAA). Эксперименты проводились в трех повторностях, и кратность изменения рассчитывалась с использованием метода 2 – ΔΔCT.

Функциональное обогащение дифференциально экспрессируемых генов

Для функционального анализа мы использовали g: profiler 31 (https://biit.cs.ut.ee/gprofiler/gost). После корректировки на FDR <5%, обогащения анализировали на GO: молекулярная функция, клеточный компартмент, биологические процессы, KEGG и Reactome.

Для определения конкретных наборов генов, модулируемых Cipa, мы использовали анализ обогащения набора генов. Мы провели предварительный ранжированный анализ для GSEA (анализ обогащения набора генов), в котором список генов был упорядочен от наивысшей положительной экспрессии гена до самой низкой отрицательной экспрессии гена. Для запроса были выбраны последние версии баз данных наборов генов. Наборы данных, содержащие более 500 и менее 15 генов, были исключены из запроса. Выход был установлен на минимальное значение отсечки p значение <0.05 и исправлено на FDR <25%. Дополнительный фильтр FDR <5% применяли для выявления значительного обогащения.

Анализ элементов ответа на эстроген (ERE)

Последовательность 5 КБ восходящей области генов загружали из браузера генома UCSC для сборки генома человека GRCh48. Сайты ERE были сопоставлены с последовательностью, расположенной выше 5 КБ, с использованием промо-инструмента 32 со значением отсечения сходства 8,7. Высокая плотность ERE в 5 КБ выше по течению приводит к понижающей регуляции генов согласно регрессионному анализу.Коэффициент наклона регрессивной линии плотности ERE (β = – 0,0044) отрицательный, а значение p является значимым (0,018). Парное сравнение плотности ERE дифференциально экспрессируемых генов и неизмененных генов проводили с использованием программного обеспечения R (версия 3.2).

Виртуальный скрининг составляющих соединений на аффинность связывания рецептора эстрогена

Виртуальный скрининг лигандов Cipa был проведен против кристаллической структуры рецептора эстрогена (PDBID: 3OS8) с использованием Autodock Vina, более точной и быстрой версии Autodock 4.Лиганды Cipa, доступные в базе данных PubChem, были загружены оттуда, трехмерные структуры остальных лигандов были нарисованы с помощью Marvin Sketch, вычислительного инструмента для рисования трехмерных и двумерных химических структур. Перед стыковкой конструкции были рандомизированы и минимизированы. Слепое исследование стыковки было выполнено для каждого лиганда, где возможным пространством поиска была полная молекула рецептора. Для каждой молекулы лекарства параметры стыковки были следующими: center_x: 9.43, center_y: 22.811, center_z: 23.418, size_x: 60, size_y: 60, size_z: 60, полнота 5000, num_modes 50,000, energy_range: 20. Кроме того, для каждого лиганда было выполнено 50 таких прогонов и конформация с минимальной энергией связывания из всех стабильные конформации из 50 прогонов (всего 1000 конформационных возможностей) были выбраны для кластерного анализа.

Анализ проводился с использованием ADT, UCSF Chimera и LigPlot +.

Анализ карты связности для выявления сходства с известными нарушениями

Набор данных карты связности в настоящее время содержит 1319 138 профилей экспрессии генов, что дает 473 647 сигнатур, сгенерированных против примерно 27000 нарушений в 9 клеточных линиях, включая MCF7, HEPG2, A549, A375, PC3, HCC515 , HT29, HA1E и VCAP.Различно экспрессируемые гены ранжировали в соответствии с изменением кратности и генерировали сигнатуру генов с повышенной и пониженной регуляцией. Сигнатура гена, содержащая действительные гены, т. Е. Имеющие действительный символ HGNC или Entrez ID, а также присутствующие в пространстве генов LINCS (представленные в данных L1000 как ориентир или хорошо выведенные), использовалась для запроса карты связности с помощью clue.io база данных пробного камня.

Лечение Cipa при инфекции DENV

Для этих экспериментов было получено институциональное разрешение на биобезопасность в Трансляционном институте здравоохранения и науки и технологий, Фаридабад, Харьяна, Индия.MCF-7 высевали по 100000 клеток на лунку в 24-луночный планшет и поддерживали в течение 24 часов (37 градусов; 5% CO2). Заражение вирусом (при 10 MOI, см. Добавление) проводили в течение 1 ч, при этом в среду добавляли 2% FBS. Через 1 час вирусной адсорбции клетки промывали PBS и DMEM с высоким содержанием глюкозы с 10% FBS с добавлением Cipa или без него (50 мкг и 100 мкг). Титры DENV в супернатанте определяли с помощью анализа бляшек через 24 часа после введения. Анализ бляшек DENV проводили в клетках BHK-21 (C-13), приобретенных в ATCC (Cat.нет. CCL-10). 50000 клеток BHK-21 высевали на лунку в 24-луночный планшет. Серийные разведения вируса добавляли в трех экземплярах и позволяли адсорбироваться в течение 1 ч с последующим нанесением 0,5% карбоксиметилцеллюлозы (CMC; Sigma). Через 72 часа клетки фиксировали в 3,7% формалине и бляшки визуализировали путем окрашивания кристаллическим фиолетовым.

siRNA-опосредованный нокдаун ESR1 в клетках MCF7

1 мкМ siRNA, нацеленная на ген ESR1, и не нацеленный контроль (NTC) смешивали с Opti-MEM (Life Technologies) и 1 мкл Lipofectamine RNAiMax до общего объема 100 мкл в 24-луночном планшете.Клетки обрабатывали трипсином и доводили объем до 60 000 клеток в 400 мкл среды, не содержащей антибиотиков. После 20 мин инкубации комплекса трансфекции в каждую лунку добавляли суспензию клеток. Эффективность нокдауна определяли с помощью qRT-PCR через 48 часов после трансфекции. Клетки инфицировали DENV-2 через 48 ч после трансфекции. Cipa добавляли в концентрации 50 мкг через 1 час вирусной адсорбции. Титры DENV-2 измеряли с помощью анализа бляшек через 24 часа после введения.

Статистический анализ

Все данные представляют собой среднее значение ± SEM; n = 3–7 в каждой группе; * р <0.05, ** p <0,01, *** p <0,001. p -значение> 0,05 считается незначимым (NS). Статистическая значимость различий определялась с помощью одно- / двустороннего t-критерия Стьюдента в зависимости от ситуации. Любые дополнительные шаги упоминаются в тексте.

Открыта регистрация и приём тезисов на 2021 год! | Сенат выпускников и профессиональных студентов

Чтобы зарегистрироваться и / или отправить тезисы, нажмите
здесь .

Комитет будет принимать тезисы до понедельника, 22 марта .Конференция состоится пятница, 9 апреля . Из-за pandmeic Covid-19 конференция будет проходить виртуально. Презентации будут предварительно записаны и представлены до понедельника, 5 апреля для рассмотрения судьями. Каждому докладчику будет выделено 5 минут в день конференции, чтобы вкратце описать свою работу и ответить на любые вопросы судей.

Center for Communication Excellence

Получите бесплатно , индивидуальную поддержку по вашему тезису, PowerPoint, плакату или самой презентации от обученных письменных или устных консультантов Center for Communication Excellence (CCE).Назначьте встречу сегодня!

Категории презентаций:

  • Устная презентация
  • Постерная презентация
  • Выставка

Право на участие:

  • Устная, стендовая и выставочная презентация : Все аспиранты и профессиональные студенты Университета штата Айова могут подавать тезисы. Мы особенно поощряем студентов колледжа дизайна к участию в выставках. Студентам, участвующим в устных презентациях, будет предоставлено 10 минут на выступление.

Правила подачи заявок:

  1. Докладчик должен быть аспирантом или студентом-профессионалом.
  2. Аннотация не должна превышать 250 слов. Реферат не должен содержать никаких таблиц, рисунков или каких-либо других графических файлов.
  3. GPSC не будет публиковать труды. Авторы по-прежнему могут отправить тезисы в GPSC, даже если они планируют представить или представили его на любой профессиональной конференции или в журнале.
  4. Выберите тему, которая больше всего соответствует вашей работе.


Устные инструкции по презентации

Студенты должны представить тезисы до 22 марта для выступления на конференции. Презентации будут организованы по темам, указанным в регистрационной форме, и разделены на небольшие группы для интерактивной сессии вопросов и ответов. Все устные презентации должны быть отправлены на [email protected] до понедельника, 5 апреля, в 23:59. Продолжительность презентаций не должна превышать 10 минут.В пятницу, 9 апреля, каждому студенту будет назначено виртуальное занятие и будет дано 5 минут, чтобы представить тему своей презентации и ответить на вопросы судей и членов аудитории. Дополнительные материалы и обучающие видеоролики для записи презентаций будут доступны на платформе конференции.

Соревнование будет происходить между другими участниками в вашем разделе с денежным призом за первое место, который будет добавлен к вашему U-счету при доступе плюс. Участники, занявшие второе место, будут участвовать в розыгрыше подарочной карты Hy-Vee.Формы судейства будут доступны на Canvas.

Инструкции по стендовой презентации

Студенты должны представить тезисы до 22 марта для выступления на конференции. Презентации будут организованы по темам, указанным в регистрационной форме, и разделены на небольшие группы для интерактивной сессии вопросов и ответов. Все стендовые презентации будут отправлены на [email protected] до понедельника, 5 апреля, в 23:59. Постеры должны быть представлены в формате PDF и сопровождаться аудиофайлом продолжительностью не более 3 минут.В пятницу, 9 апреля, каждому студенту будет назначено виртуальное занятие и будет дано 5 минут, чтобы представить тему своей презентации и ответить на вопросы судей и членов аудитории. Дополнительные материалы и обучающие видеоролики для записи презентаций будут доступны на платформе конференции.

Инструкции по презентации выставки

Выставки будут обрабатываться в индивидуальном порядке, мы понимаем, что предварительно записанные и живые сеансы будут работать для каждого докладчика.С любыми вопросами обращайтесь по адресу [email protected]

Участие в художественных конкурсах, фотографиях, лимериках, поэзии и т. Д. Не будет иметь отдельного раздела, они будут доступны для просмотра на холсте, а участники будут участвовать в розыгрыше подарочных карт.

В зависимости от качества и количества поданных тезисов тезисы, представленные для молниеносных выступлений и / или устной исследовательской презентации, могут быть перенесены на плакат.

Оставить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *