История генетики человека: 1. Генетика. История развития науки

Содержание

1. Генетика. История развития науки

Термин «генетика» предложил в \(1905\) году У. Бэтсон.

Генетика — наука, изучающая закономерности наследственности и изменчивости организмов.

Наследственностью называется свойство организмов передавать потомкам особенности строения, физиологические свойства и характер индивидуального развития.

 

Изменчивостью называется способность живых организмов изменять свои признаки.

 

В своём развитии генетика прошла ряд этапов.

 

Наследственностью люди интересовались очень давно. С развитием сельского хозяйства сформировалась прикладная наука селекция, которая занималась созданием и формированием новых пород животных и сортов растений. Но объяснить механизмы передачи признаков потомкам селекционеры не могли. 

  

Первый этап развития генетики — изучение наследственности и изменчивости на организменном уровне.

  

Этот этап связан с работами Г. Менделя

. В \(1865\) г. в работе «Опыты над растительными гибридами» он описал результаты своих исследований закономерностей наследования признаков у гороха.

 

Г. Мендель установил дискретность (делимость) наследственных факторов и разработал гибридологический метод изучения наследственности.

 

Дискретность наследственности состоит в том, что отдельные свойства и признаки организма развиваются под контролем наследственных факторов, которые при слиянии гамет и образовании зиготы не смешиваются, а при формировании новых гамет наследуются независимо друг от друга.

 

В \(1909\) г. В. Иоганнсен назвал эти факторы генами.

 

Значение открытий Г. Менделя оценили только после того, как его результаты были подтверждены в \(1900\) г. тремя биологами независимо друг от друга:

Х. де Фризом в Голландии, К. Корренсом в Германии и Э. Чермаком в Австрии. Этот год считается годом возникновения науки генетики.

 

Менделевские законы наследственности заложили основу теории гена, а генетика превратилась в быстро развивающуюся отрасль биологии.

 

В \(1901\)–\(1903\) гг. де Фриз выдвинул мутационную теорию изменчивости, которая сыграла большую роль в дальнейшем развитии генетики.

 

Второй этап развития генетики — изучение закономерностей наследования признаков на хромосомном уровне.

 

Была установлена взаимосвязь между менделевскими законами наследования и распределением хромосом в процессе клеточного деления (митоз) и созревания половых клеток (мейоз).

 

Изучение строения клетки привело к уточнению строения, формы и количества хромосом и помогло установить, что гены — это участки хромосом.

 

В  \(1910\)–\(1911\) гг. американский генетик Т. Г. Морган и его сотрудники провели исследования закономерностей наследования на мушках дрозофилах. Они установили, что гены расположены в хромосомах в линейном порядке и образуют группы сцепления.

 

Морган установил также закономерности наследования признаков, сцепленных с полом.

 

Эти открытия позволили сформулировать хромосомную теорию наследственности.

 

Третий этап развития генетики — изучение наследственности и изменчивости на молекулярном уровне.

 

На этом этапе были изучены взаимоотношения между генами и ферментами и сформулирована теория «один ген

один фермент»: каждый ген контролирует синтез одного фермента, а фермент контролирует одну биохимическую реакцию.

 

В \(1953\) г. Ф. Крик и Дж. Уотсон создали модель молекулы ДНК в виде двойной спирали и объяснили способность ДНК к самоудвоению. Стал понятен механизм изменчивости: любые отклонения в структуре гена, однажды возникнув, в дальнейшем воспроизводятся в дочерних нитях ДНК.

 

Эти положения были подтверждены экспериментами. Уточнилось понятие гена, был расшифрован генетический код и изучен механизм биосинтеза. Были разработаны методы искусственного получения мутаций и с их помощью созданы новые ценные сорта растений и штаммы микроорганизмов.

В последние десятилетия сформировалась генная инженерия — система приёмов, позволяющих синтезировать новый ген или выделить его из одного организма и ввести в генетический аппарат другого организма.

 

В последнее десятилетие  \(20\) века были расшифрованы геномы многих простых организмов. В начала \(21\) века (\(2003\) г.) был завершён проект по расшифровке генома человека.

 

На сегодняшний день существуют базы данных геномов многих организмов. Наличие такой базы данных человека имеет большое значение в предупреждении и исследовании многих заболеваний.

История развития генетики

Генетика – наука, изучающая закономерности и материальные основы наследственности и изменчивости организмов, а также механизмы эволюции живого. Наследственностью называется свойство одного поколения передавать другому признаки строения, физиологические свойства и специфический характер индивидуального развития. Свойства наследственности реализуются в процессе индивидуального развития.

Наряду со сходством с родительскими формами в каждом поколении возникают те или иные различия у потомков, как результат проявления изменчивости.

Изменчивостью называется свойство, противоположное наследственности, заключающееся в изменении наследственных задатков – генов и в изменении их проявления под влиянием внешней среды. Отличия потомков от родителей возникают также вследствие возникновения различных комбинаций генов в процессе мейоза и при объединении отцовских и материнских хромосом в одной зиготе. Здесь надо отметить, что выяснение многих вопросов генетики, особенно открытие материальных носителей наследственности и механизма изменчивости организмов, стало достоянием науки последних десятилетий, выдвинувших генетику на передовые позиции современной биологии. Основные закономерности передачи наследственных признаков были установлены на растительных и животных организмах, они оказались приложимы и к человеку. В своем развитии генетика прошла ряд этапов.

Первый этап ознаменовался открытием Г. Менделем (1865) дискретности (делимости) наследственных факторов и разработкой гибридологического метода, изучения наследственности, т. е. правил скрещивания организмов и учета признаков у их потомства. Дискретность наследственности состоит в том, что отдельные свойства и при знаки организма развиваются под контролем наследственных факторов (генов), которые при слиянии гамет и образовании зиготы не смешиваются, не растворяются, а при формировании новых гамет наследуются независимо друг от друга.

Значение открытий Г. Менделя оценили после того, как его законы были вновь переоткрыты в 1900 г. тремя биологами независимо друг от друга: де Фризом в Голландии, К. Корренсом в Германии и Э. Чермаком в Австрии. Результаты гибридизации, полученные в первое десятилетие XX в. на различных растениях и животных, полностью подтвердили менделевские законы наследования признаков и показали их универсальный характер по отношению ко всем организмам, размножающимся половым путем. Закономерности наследования признаков в этот период изучались на уровне целостного организма (горох, кукуруза, мак, фасоль, кролик, мышь и др.).

Менделевские законы наследственности заложили основу теории гена – величайшего открытия естествознания XX в., а генетика превратилась в быстро развивающуюся отрасль биологии. В 1901–1903 гг. де Фриз выдвинул мутационную теорию изменчивости, которая сыграла большую роль в дальнейшем развитии генетики.

Важное значение имели работы датского ботаника В. Иоганнсена, который изучал закономерности наследования на чистых линиях фасоли. Он сформулировал также понятие «популяциям» (группа организмов одного вида, обитающих и размножающихся на ограниченной территории), предложил называть менделевские «наследственные факторы» словом ген, дал определения понятий «генотип» и «фенотип».

Второй этап характеризуется переходом к изучению явлений наследственности на клеточном уровне (питогенетика). Т. Бовери (1902–1907), У. Сэттон и Э. Вильсон (1902–1907) установили взаимосвязь между менделевскими законами наследования и распределением хромосом в процессе клеточного деления (митоз) и созревания половых клеток (мейоз). Развитие учения о клетке привело к уточнению строения, формы и количества хромосом и помогло установить, что гены, контролирующие те или иные признаки, не что иное, как участки хромосом. Это послужило важной предпосылкой утверждения хромосомной теории наследственности. Решающее значение в ее обосновании имели исследования, проведенные на мушках дрозофилах американским генетиком Т. Г. Морганом и его сотрудниками (1910–1911). Ими установлено, что гены расположены в хромосомах в линейном порядке, образуя группы сцепления. Число групп сцепления генов соответствует числу пар гомологичных хромосом, и гены одной группы сцепления могут перекомбинироваться в процессе мейоза благодаря явлению кроссинговера, что лежит в основе одной из форм наследственной комбинативной изменчивости организмов. Морган установил также закономерности наследования признаков, сцепленных с полом.

Третий этап в развитии генетики отражает достижения молекулярной биологии и связан с использованием методов и принципов точных наук – физики, химии, математики, биофизики и др. – в изучении явлений жизни на уровне молекул. Объектами генетических исследований стали грибы, бактерии, вирусы. На этом этапе были изучены взаимоотношения между генами и ферментами и сформулирована теория «один ген – один фермент» (Дж. Бидл и Э. Татум, 1940): каждый ген контролирует синтез одного фермента; фермент в свою очередь контролирует одну реакцию из целого ряда биохимических превращений, лежащих в основе проявления внешнего или внутреннего признака организма. Эта теория сыграла важную роль в выяснении физической природы гена как элемента наследственной информации.

В 1953 г. Ф. Крик и Дж. Уотсон, опираясь на результаты опытов генетиков и биохимиков и на данные рентгеноструктурного анализа, создали структурную модель ДНК в форме двойной спирали. Предложенная ими модель ДНК хорошо согласуется с биологической функцией этого соединения: способностью к самоудвоению генетического материала и устойчивому сохранению его в поколениях – от клетки к клетке. Эти свойства молекул ДНК объяснили и молекулярный механизм изменчивости: любые отклонения от исходной структуры гена, ошибки самоудвоения генетического материала ДНК, однажды возникнув, в дальнейшем точно и устойчиво воспроизводятся в дочерних нитях ДНК. В последующее десятилетие эти положения были экспериментально подтверждены: уточнилось понятие гена, был расшифрован генетический код и механизм его действия в процессе синтеза белка в клетке. Кроме того, были найдены методы искусственного получения мутаций и с их помощью созданы ценные сорта растений и штаммы микроорганизмов – продуцентов антибиотиков, аминокислот.

В последнее десятилетие возникло новое направление в молекулярной генетике – генная инженерия – система приемов, позволяющих биологу конструировать искусственные генетические системы. Генная инженерия основывается на универсальности генетического кода: триплеты нуклеотидов ДНК программируют включение аминокислот в белковые молекулы всех организмов – человека, животных, растений, бактерий, вирусов. Благодаря этому можно синтезировать новый ген или выделить его из одной бактерии и ввести его в генетический аппарат другой бактерии, лишенной такого гена.

Таким образом, третий, современный этап развития генетики открыл огромные перспективы направленного вмешательства в явления наследственности и селекции растительных и животных организмов, выявил важную роль генетики в медицине, в частности, в изучении закономерностей наследственных болезней и физических аномалий человека.

как развивалась генетика человека и не только

Введение в историю генетики

В сегодняшний век интеграции очень сложно определить границы практически любой науки. Это касается в том числе и генетики. Мы, конечно, можем использовать заштампованное «наука о наследственности и изменчивости» но это не передает всей сути и масштаба этой дисциплины. При том, что генетика присутствует везде – медицине, истории, криминалистике и даже спорте. А что уж говорить о современной биологии.

Однако еще относительно недавно эта молодая наука была чуть ли не самой обособленной областью биологической науки. И лишь в последней трети прошлого века начался её бурный прогресс.

Как генетика стала всеобъемлющей

Особенностью генетики всегда являлась её синтетическая методология, отличающая её от аналитической методологии остальных направлений биологии. Так, исследуя объект своего изучения, она не делила его на части, а косвенно, наблюдая за целым (соотношение признаков при скрещиваниях) и основываясь на математике, изучала его. Подтверждением же верности её выводов были живые организмы с предсказанными признаками. И как же обособленная наука заняла, возможно, центральное место в современной биологии?

Генетика – молодая наука

Начиная с 50-х годов ХХ века бурно развивалась другая новая наука – молекулярная биология. Аналитическая наука изначально совершено противоположна генетике. Однако предметы этих двух дисциплин во многом пересекались: они обе занимались изучением передачи и реализации наследственной информации, однако двигались они с противоположных сторон. Генетика, если можно так сказать, «снаружи», молекулярная биология – «изнутри».

И наконец в конце ХХ века генетика и молекулярная биология «встретились», и умозрительные объекты генетических исследований обрели конкретную физико-химическую форму, а молекулярная биология стала синтетической наукой. И именно с этого момента до неразличимости стерлись границы генетики как науки – было невозможно определить, где кончается молекулярная биология или начинается генетика. А для обозначения новой зародившейся синтетической науки появилось название «молекулярная генетика».

Генетика

А где же классическая генетика?

Титулом «классическая генетика» стали называть генетику домолекулярного периода вместе со всеми её подходами, основанными на теории вероятности и скрещиваниях. Но вместе с этим титулом её отправили в «почетную отставку». Классическая генетика – это наука, в которой не совершается больше открытий, но крайне необходимая для понимания основных закономерностей наследственности и изменчивости, без понимания которых многие области научного знания не достигли бы тех высот, которые им уже покорились.

Когда зародилась генетика?

Принято говорить, что генетика зародилась, когда чешский монах-августинец Грегор Мендель провел свои опыты на горохе. Стоит отметить что научное сообщество того периода не придало значения работам Менделя, и признание они получили спустя не один десяток лет. Но вопросами наследственности и изменчивости ученые занимались и до него, но о их работах вспоминают очень редко.

Так еще в XVIII веке ботаники начали заниматься экспериментальным изучением наследования признаков растений. Стоит упомянуть Йозефа Готлиба Кельрейтера, с 1756 по 1761 г.г., работавшего в Академии наук в Санкт-Петербурге. Именно там он провел первые опыты по искусственной гибридизации растений, результаты 136 были опубликованы.

В опытах с дурманом, табаком и гвоздиками Кельрейтор установил равноправие “матери”и “отца” при передаче признаков потомкам, а также доказал существование пола у растений. Но самым важным вкладом его в науку стал новый метод изучения наследственности – метод искусственной гибридизации. Используя его, французы Огюстен Сажрэ и Шарль Виктор Ноден в середине XIX в., открыли явление доминантности. Все накопленные факты требовали своего осмысления. Именно в осмысление этих фактов и заключается главная залуга Грегора Менделя.

Грегор Мендель

Современная генетика

Современная генетика уже очень далеко шагнула от классического учения Менделя и приобретает все большее значение в сферах медицины, биологии, сельского хозяйства и животноводства. Современная генетика – это прежде всего молекулярная генетика. На ее основе производится селекция полезных микроорганизмов, растений и животных. Генетически модифицированные организмы обладают полезными свойствами, не характерными для их родственников из “дикой” природы. Например, листья генетически модифицированного картофеля являются несъедобными для колорадского жука – злейшего врага картошки и тех, кто ее выращивает.  Количество генетически модифицированных продуктов, потребляемых человечеством, растет с каждым годом.

Учитывая тот факт, что огромное количество заболеваний человека являются генетически обусловленными, невозможно переоценить значение генетики для медицины. После того, как в начале 21 века был расшифрован геном человека, методы профилактики наследственных патологий и борьбы с негативным воздействием генов становятся все эффективнее. Например, вероятность и риск развития  хронических заболеваний может быть предсказан задолго до рождения ребенка, также появляются методы, позволяющие свести этот риск к минимуму.

Генная инженерия

Если Вам нужно разобраться с решением задач или курсовой по генетике в короткий срок – не стесняйтесь обращаться к нашим авторам. Мы поможем решить любой вопрос с учебой, даже если ситуация кажется безнадежной!

1.1. История генетики. Генетика человека с основами общей генетики [Учебное пособие]

Читайте также

ОСНОВНЫЕ ВЕХИ ГЕНЕТИКИ И ГЕНОМИКИ

ОСНОВНЫЕ ВЕХИ ГЕНЕТИКИ И ГЕНОМИКИ Inventas vitam juvat excoluisse per artes. Изобретения улучшают жизнь, искусство украшает ее. Надпись на нобелевской медали, фраза из «Энеиды» Вергилия 1865 годОткрытие Г. Менделем (1822–1884) факторов наследственности и разработка гибридологического метода,

ОСНОВНЫЕ ВЕХИ ГЕНЕТИКИ И ГЕНОМИКИ

ОСНОВНЫЕ ВЕХИ ГЕНЕТИКИ И ГЕНОМИКИ Inventas vitam juvat excoluisse per artes. Изобретения улучшают жизнь, искусство украшает ее. Надпись на нобелевской медали, фраза из «Энеиды» Вергилия 1865 год Открытие Г. Менделем (1822–1884) факторов наследственности и разработка гибридологического метода,

Глава 7 Основы генетики

Глава 7 Основы генетики Тупиковые вопросы дарвинизмаПричина ошибочного использования эво­люционной теории — природа механизма на­следования, который и до сих пор до конца не изучен и тем более не был понят в XIX в. Спенсер ожидал быстрых изменений в чело­веческом

Достижения сравнительной генетики

Достижения сравнительной генетики Сравнительный анализ митохондриальной ДНК и Y-хромосом современных людей показал, что человечество происходит от небольшой популяции, жившей в восточной Африке 160-200 тыс лет назад. Homo sapiens оказался молодым видом с очень низким уровнем

Практическое применение менделевской генетики

Практическое применение менделевской генетики Несомненно, наибольшее применение менделевская генетика находит в животноводстве и растениеводстве. Правда, ее можно приложить и к человеку, но здесь возможности ее ограниченны. Предположим, мужчина или женщина перед

Глава 1. История и значение генетики

Глава 1. История и значение генетики Генетика – это сердцевина биологической науки. Лишь в рамках генетики разнообразие жизненных форм и процессов может быть осмыслено как единое целое. Ф. Айала, американский генетик, автор учебника «Современная генетика» Генетика

1.2. Ключевые вопросы в истории генетики

1.2. Ключевые вопросы в истории генетики В истории генетики (и ее предыстории) можно выделить ряд ключевых тем, по их значению для научного мировоззрения и остроте дискуссий. В XVII–XVIII вв. – это была проблема «преформизм – эпигенез», причем лагерь преформистов делился на

1.3. Структура генетики и ее общебиологическое значение

1.3. Структура генетики и ее общебиологическое значение Современная генетика представляет собой обширное древо производных дисциплин. Ее специализированные разделы стали рассматриваться как крупные самостоятельные науки – генетика человека, цитогенетика,

10.1. Человек как объект генетики

10.1. Человек как объект генетики Человек представляет собой довольно трудный объект для генетических исследований. Как высокоорганизованный вид, он имеет сложную генетическую организацию. Однако объем и структура генетического материала человека не имеет

Основные понятия генетики

Основные понятия генетики Предметом изучения генетики являются два неразрывных свойства всех живых организмов — наследственность и изменчивость. Изменчивость представлена многообразием форм внутри каждого вида, породы и даже одного помета. Но в то же время все

Генетики, «заигравшиеся в богов»

Генетики, «заигравшиеся в богов» 14 апреля 2006 года на проповеди по случаю Страстной пятницы высший иерарх Римско–католической церкви, Папа Римский Бенедикт XVI, сделал ясную и смелую декларацию. Римский папа осудил ученых–генетиков, «которые заигрались в Бога».Обращаясь

Тема 1. История и значение генетики

Тема 1. История и значение генетики Генетика – это сердцевина биологической науки. Лишь в рамках генетики разнообразие жизненных форм и процессов может быть осмыслено как единое целое. Ф. Айала, американский генетик Генетика изучает два неразрывных свойства живых

В тупике генетики

В тупике генетики Если не курение, то тогда что вызывает рак? Ведь заболеваемость раком продолжает расти и, что особенно страшно, рак переползает на все более молодых.Сначала немного в общем о биологии и медицине.В том контексте, в котором сегодня используется понятие

История генетики

Хотя история генетики началась в XIX веке, еще древние люди замечали, что животные и растения передают в ряду поколений свои признаки. Другими словами, было очевидно, что в природе существует наследственность. При этом отдельные признаки могут изменяться. То есть помимо наследственности в природе существует изменчивость.

Наследственность и изменчивость относятся к основным свойствам живой материи. Долгое время (до XIX-XX веков) истинная причина их существования была скрыта от человека. Это порождало ряд гипотез, которые можно разделить на два типа: прямое наследование и непрямое наследование.

Приверженцы прямого наследования (Гиппократ, Ламарк, Дарвин и др.) предполагали, что дочернему организму через определенные субстанции (геммулы по Дарвину), собирающиеся в половых продуктах, передается информация от каждого органа и каждой части тела родительского организма. По Ламарку следовало, что повреждение или сильное развитие органа напрямую передастся следующему поколению. Гипотезы непрямого наследования (Аристотель в IV в. до н. э., Вейсман в XIX в.) утверждали, что половые продукты образуются в организме отдельно и «не знают» об изменениях в органах тела.

В любом случае обе гипотезы искали «субстрат» наследственности и изменчивости.

История генетики как науки началась с работ Грегора Менделя (1822-1884), который в 60-х годах провел систематические и многочисленные опыты над горохом, установил ряд закономерностей наследственности, впервые высказал предположения об организации наследственного материала. Правильный выбор объекта исследования, изучаемых признаков, а также научная удача позволили ему сформулировать три закона:

  1. Закон единообразия гибридов первого поколения.

  2. Закон расщепления во втором поколении.

  3. Закон независимого наследования разных признаков.

Мендель понял, что наследственный материал дискретен, представлен отдельными задатками, передающимися потомству. При этом каждый задаток отвечает за развитие определенного признака организма. Признак обеспечивается парой аллельных задатков, пришедших с половыми клетками от обоих родителей.

Грегор Мендель и открытые им законы наследственности – 1860-е годы

В то время научному открытию Менделя не придали особого значения. Его законы были переоткрыты в начале XX века несколькими учеными на разных растениях и животных.

В 80-х годах XIX века были описаны митоз и мейоз, в ходе которых между дочерними клетками закономерно распределяются хромосомы. В начале XX века Т. Бовери и У. Сеттон пришли к выводу, что преемственность свойств в ряду поколений организмов определяется преемственностью их хромосом. То есть к этому периоду времени научный мир понял, в каких структурах заключается «субстрат» наследственности.

У. Бэтсоном был открыт закон чистоты гамет, а наука о наследственности и изменчивости впервые в истории была названа им генетикой. В. Иогансен ввел в науку понятия гена (1909 г.), генотипа и фенотипа. В то время ученые уже поняли, что ген представляет собой элементарный наследственный фактор. Но его химическая природа еще не была известна.

В 1906 году было открытоявление сцепления генов, в том числе наследование признаков, сцепленное с полом. Понятие генотипа подчеркивало, что гены организма не просто набор независимых единиц наследственности, они образуют систему, в которой наблюдаются определенные зависимости.

Параллельно с изучением наследственности происходили открытия закономерностей изменчивости. В 1901 году де Фризом были заложены основы учения о мутационной изменчивости, связанной с возникновением изменений в хромосомах, что приводит к возникновению изменений признаков. Чуть позже было обнаружено, что мутации часто возникают при воздействии радиации, определенных химических веществ и др. Таким образом было доказано, что хромосомы являются не только «субстратом» наследственности, но также изменчивости.

В 1910 году, во многом обобщая более ранние открытия, группой Т. Моргана была разработана хромосомная теория:

  1. Гены находятся в хромосомах и расположены там линейно.

  2. У каждой хромосомы есть гомологичная ей.

  3. От каждого из родителей потомок получает по одной из каждых гомологичных хромосом.

  4. Гомологичные хромосомы содержат одинаковый набор генов, но аллели генов могут быть разными.

  5. Гены, находящиеся в одной хромосоме, наследуются совместно (сцеплено) при условии их близкого расположения.

  6. Чем дальше друг от друга в хромосоме находятся гены, тем более вероятен кроссинговер (обмен участками с гомологичной хромосомой).

Томас Морган изучал хромосомы, открыл кроссинговер – 1910-е годы

Среди прочего в начале XX века была обнаружена внехромосомная, или цитоплазматическая, наследственность, связанная с митохондриями и хлоропластами.

Химический анализ хромосом показал, что они состоят из белков и нуклеиновых кислот. В первой половине XX века многие ученые склонялись к мнению, что белки являются носителями наследственности и изменчивости.

В 40-х годах XX века в истории генетики происходит скачок. Исследования переходят на молекулярный уровень.

В 1944 году обнаруживается, что за наследственные признаки отвечает такое вещество клетки как ДНК. ДНК признается носителем генетической информации. Чуть позже было сформулировано, что один ген кодирует один полипептид.

В 1953 г. Д. Уотсон и Ф. Крик расшифровали структуру ДНК. Оказалось что это двойная спираль, состоящая из нуклеотидов. Ими была создана пространственная модель молекулы ДНК.

Фрэнсис Крик и Джеймс Уотсон открыли структуру ДНК – 1950-е годы

Позже были открыты следующие свойства генетического кода (60-е годы):

  1. Каждая аминокислота полипептида кодируется триплетом (тремя азотистыми основаниями в ДНК).

  2. Каждую аминокислоту кодирует один триплет или более.

  3. Триплеты не перекрываются.

  4. Считывание начинается со стартового триплета.

  5. В ДНК нет «знаков препинания».

В 70-х годах в истории генетики происходит еще один качественный скачок – развитие генной инженерии. Ученые начинают синтезировать гены, изменять геномы. В это время активно изучаются молекулярные механизмы, лежащие в основе различных физиологических процессов.

В 90-х годах секвенируются геномы (расшифровывается последовательность нуклеотидов в ДНК) многих организмов. В 2003 году был завершен проект по секвенированию генома человека. В настоящее время существуют геномные базы данных. Это дает возможность комплексно исследовать физиологические особенности, заболевания человека и других организмов, а также определять родственную связь между видами. Последнее позволило систематике живых организмов выйти на новый уровень.

Открытые видеолекции учебных курсов МГУ

Список всех тем лекций

Лекция 1. Основные понятия генетики. История генетики.
Генетические портреты Наследственность Изменчивость Интеллект Восприятие Определение генетики История генетики Грегор Мендель Законы Менделя Открытия в генетике после Менделя Закон Харди-Вайнберга Хромосомная теория наследственности и другие открытия в генетике

Лекция 2. Молекулярные механизмы наследственности. Генетика оплодотворения и развития.
Теории в биологии Опыты Фридриха Гриффитса Эра ДНК Открытие свойств ДНК Структура ДНК Генетический код Полуконсервативный синтез ДНК Транскрипция Трансляция Прямая и обратная генетика Определение гена История генетики Проблемы генетики Генетика оплодотворения Генетика развития Фенотип – взаимодействие генов со средой Эпигенетическое наследование Определение генома Геном человека Клонирование организмов Происхождение и эволюция человека Фармакогенетика

Лекция 3. Целенаправленное изменение организмов. Генетический анализ.
Дивергентная эволюция Гибридизация Горизонтальный перенос генов Трансгенные организмы Модель сетчатой эволюции Целенаправленное изменение организмов Клонирование Стволовые клетки Определение генетического признака и фенотипа Определение гена и аллеля Качественные и количественные признаки Классификация качественных признаков Уровни организации живой природы Методы генетики Генетический анализ Структура хромосом

Лекция 4. Овариальный цикл и оплодотворение у человека.
Чередование гапло- и диплофаз в жизненных циклах Митоз и мейоз Человеческий ооцит и сперматозоид Овариальный цикл и оплодотворение Эмбриональное развитие человека Наследование простых признаков Значение для науки Типы скрещиваний Модельные объекты в генетике Определение чистых линий Первый закон Менделя Тетрадный анализ Второй закон Менделя Анализирующее скрещивание Взаимодействие аллелей

Лекция 5. Примеры генетических отклонений. Некоторые наследственные признаки человека.
Кариотип человека Наследование признаков, сцепленных с полом Голандрическое наследование Гемофилия в королевской и царской семьях Примеры генетических отклонений Некоторые наследственные признаки человека

Лекция 6. Аутосомно-доминантное и аутосомно-рецессивное наследование.
Аутосомно-доминантное наследование Аутосомно-рецессивное наследование Наследование, сцепленное с полом Множественный аллелизм Причины возникновения множественного аллелизма Мутация в гене фенилаланингидроксилазы

Лекция 7. Группы крови. Третий закон Менделя.
Группы крови Совместимость при переливании Анализ признаков Полигенное наследование Условия выполнения менделевских закономерностей Родословная с аутосомно-доминантным наследованием Нарушение условий выполнения наследования Репродуктивная биология

Лекция 8. Серповидноклеточная анемия. Наследование глухонемоты.
Серповидноклеточная анемия Наследование глухонемоты Генетический анализ Адаптация к инсоляции Наследование цвета кожи Наследование цвета волос

Лекция 9. Комплементарное взаимодействие генов. Наследование цвета глаз. Гены, участвующие в биосинтезе пигментов.
Комплементарное взаимодействие генов Наследование цвета глаз Примеры генов, участвующие в биосинтезе пигментов Биосинтез пигментов Окрашивание оперения птиц Природа неотении у аксолотля Механизмы регуляции работы ферментов Структура рибосом Механизм РНК-интерференции Пути метаболизма фениаланина Примеры комплементарного взаимодействия генов Рецессивный эпистаз Доминантный эпистаз Полимерия

Лекция 10. Детерминация пола. Патологии детерминации пола.
Детерминация пола Детерминация пола у человека Последовательность событий при детерминации пола Детерминация мужского пола Гормоны, участвующие в определении пола Роль гена SRY в проявлении тестикулярной феминизации Синдром нечувствительности к андрогенам Частота гермафродитизма у человека Многоплодность

Лекция 11. Бесплодие и его причины. События после оплодотворения. Генетические аспекты поведения.
Причины бесплодия События после оплодотворения Интрацитоплазматическая инъекция сперматозоида Криоконсервация эмбрионов Иммунологические причины бесплодия Примеры

Лекция 12. Генетические аспекты поведения.
Аспекты поведения моллюсков Аспекты поведения насекомых Гигиеническое поведение пчёл Генетический контроль биоритмов Фиксированный комплекс действий дрозофилы Аспекты акустического поведения Пример вклада генов в поведение насекомых Социальная амнезия у млекопитающих Влияние гормонов на поведение рабочих пчёл Влияние гормонов на модификацию пола Родительское поведение Экспрессивность генов Плейотропия “География” генов Эпигенетика

Прочесть историю по ДНК | Наука и жизнь

Ещё совсем недавно заглянуть в прошлое — узнать, где жили люди, какой образ жизни вели, на каком языке говорили и кого из них можно считать нашими предками, — могли только археологи, историки и лингвисты. В последние десятилетия к ним присоединились генетики, которые создали мощнейший инструмент — исследование древней ДНК (палеоДНК). Молекула ДНК, основной носитель информации в клетке, оказалась поразительно устойчива и сохраняется в ископаемых останках в течение десятков тысяч лет. В ней законсервированы ответы на многие вопросы истории человечества.

Археологи работают в Денисовой пещере. На заднем плане видны пронумерованные культурные слои пещеры. Фото А. П. Бужиловой.

Приготовление образца для выделения древней ДНК (высверливание ткани зуба). Фото Олега Балановского.

Образцы для выделения древней ДНК облучают ультрафиолетом, чтобы уничтожить биологические молекулы на поверхности, которые могут принадлежать современному человеку. Вся внутренняя ДНК при этом остаётся нетронутой.Фото Олега Балановского.

Раскопки Денисовой пещеры (Алтайский край) позволили впервые установить строгую хронологическую последовательность развития и смены древних культур от эпохи раннего неолита до этнографической современности. По мнению заведующего лабораторией млекопитающих Палеонтологического института им. А. А. Борисяка РАН А. К. Агаджаняна, обитатели 11-го культурного слоя Денисовой пещеры пользовались огнём. Именно в этом слое были найдены останки древнего человека, представляющего особую ветвь в эволюции рода Homo. Этот вид получил название денисовского человека. Фото Александра Агаджаняна.

Скелетные останки человека из курганного могильника Натухаевская-3 в Краснодарском крае (майкопская культура). Фото А. Д. Колпаковой.

Ключевые миграции, сформировавшие генофонд Европы. Неолитические земледельцы с Ближнего Востока и из Анатолии пришли в Европу и смешались с мезолитическими охотниками-собирателями в генофонде первых неолитических европейских земледельцев (короткие белые стрелки). Они же внесли вклад в генофонд кочевников бронзового века ямной культуры (пунктирная розовая стрелка). Миграция «ямников» в Европу добавила степной компонент в генофонд европейских земледельцев (жёлтая стрелка). Рисунок О. П. Балановского.

По материалам статьи: I. Morozova et al. Toward high-resolution population genomics using archaeological samples // DNA research, 2016, published online: July 19, 2016, doi: 10.1093/dnares/dsw029.

Надо сказать, что и по современной ДНК генетики реконструируют исторические события: по сегодняшней структуре генофонда догадываются, какие события могли её сформировать, а используя знания о скорости мутаций, отсчитывают время назад по так называемым молекулярным часам. Но современная ДНК даёт возможность лишь смоделировать прошлое, а древняя ДНК — непосредственно прочитать то, что в ней записано.

Первую древнюю ДНК генетики выделили ещё в 1984 году из высохшей мышцы вымершего родственника зебры. В 1991-м ДНК впервые извлекли из ископаемых костей человека. Но её анализ целиком зависел от развития технологий, поэтому стал возможен с появлением метода полимеразной цепной реакции (ПЦР) и вышел на новый уровень с возникновением методов секвенирования нового поколения. Эти методы радикально облегчили прочтение последовательности нуклеотидов (кирпичиков, из которых состоит ДНК). Самое главное — они позволяют прочитать не целую молекулу, а разорванную на мелкие кусочки, как обычно и происходит с ДНК в процессе длительного хранения в ископаемых костях. В 1991 году биологи впервые извлекли палеоДНК человека, в 2010-м смогли прочитать древний геном целиком — из костей неандертальца возрастом 38 тыс. лет и из костей палеоэскимоса возрастом 4 тыс. лет.

С этого времени число прочитанных древних геномов нарастает лавинообразно, с каждым годом публикуется всё больше статей в этой области. Вторгшись в храм древности со своими ДНК-перфораторами, генетики расспросили старожилов храма — прежде всего, археологов — о проблемах, которые надо решить. По словам этнографа и антрополога М. В. Витова, «антропологические измерения предоставляют историку чрезвычайно обильный и многочисленный, но однообразный и односторонний материал». Это в полной мере относится и к генетике. О древних эпохах генетика предоставляет также материал обильный, но односторонний: только о движениях самого населения, но не о его культуре или языке. Зато на вопрос о населении: была на данной территории преемственность населения или его смена произошла в результате миграции — древняя ДНК даёт прямой ответ. Эти ответы порой подтверждают построения археологов, историков и лингвистов, порой они оказываются неожиданными. С данного момента начинается тот междисциплинарный диалог между представителями биологических наук (генетики и антропологии) и гуманитарных дисциплин (археологии, истории, лингвистики), который может привести к взаимопониманию и сближению точек зрения. Так уточняется картина мира. «Генетика вносит важный фрагмент в общий пазл. Не больше, но и не меньше» — так о роли генетики в изучении истории человека сказал Вольфганг Хаак, один из ведущих специалистов созданного недавно Института истории человечества Общества Макса Планка (Max Planck Institute for the Science of Human History) в Йене, Германия.

Почему это трудно

Изучать древнюю ДНК очень непросто, поэтому даже сегодня в мире существует лишь несколько лабораторий, которые делают это качественно. Самая большая проблема — загрязнение (специалисты говорят — контаминация) материала. Лежащие в земле тысячи лет кости заселены бактериями и грибами, поэтому первая задача состоит в том, чтобы отделить человеческую ДНК от микробной. С другой стороны, надо не допустить её загрязнения современной ДНК, прежде всего, от людей, которые с ней работают. Поэтому помещения для работы с древней ДНК должны отвечать стандартам чистоты, а сами исследователи работать в экипировке, напоминающей космические скафандры.

Есть ещё одна проблема: в ископаемых образцах, в данном случае в человеческих останках из древних захоронений, содержится очень мало ДНК, пригодной для выделения и анализа. Иногда специалистам приходится работать всего лишь с несколькими молекулами. Наконец, и самих образцов, то есть человеческих останков, в которых сохранилась ДНК, пока ещё мало. Поэтому трудно набрать нужную статистику, что создаёт трудности в интерпретации полученных результатов. Кстати, сохранность ДНК в палеоматериале зависит в первую очередь не от возраста останков, а от условий, в которых они хранились в природе. Главные её враги — высокая температура и влажность. Именно поэтому большинство изученных древних геномов относятся к средней полосе или северу; в Южной Европе и на Ближнем Востоке останков гораздо меньше, а в Африке пока только один материал оказался пригодным для изучения.

В нашей стране лаборатории, которые пытаются работать с древней ДНК, можно пересчитать по пальцам. Собственно, лабораторный анализ проводят лишь новосибирские исследователи (группа Александра Пилипенко) и группа Евгения Рогаева в Институте общей генетики (ИОГен) РАН. Некоторые исследовательские коллективы, например лаборатории популяционной генетики человека в Медико-генетическом научном центре (МГНЦ) и Институте общей генетики РАН, успешно сотрудничают с ведущими зарубежными коллективами, участвуют в биоинформационном анализе и обобщении данных. Помимо всего прочего, Россия — неисчерпаемый источник палеоматериала, где благодаря холодному климату останки хорошо сохраняются.

Как пересекались «параллельные человечества»

Прежде всего, исследования древней ДНК дали возможность описать наши отношения с другими видами людей, уточнив представление о «чистоте» вида Homo sapiens. О неандертальцах науке известно очень давно, и антропологи много спорили, смешивались ли ветви сапиенсов и неандертальцев. Эти вымершие представители «другого человечества» генетически были изучены в группе Сванте Паабо, самого известного в мире специалиста по древней ДНК (Институт эволюционной антропологии Общества Макса Планка в Лейпциге, нем. Max Planck Institut fur evolutionare Anthropologie). Сначала он изучил митохондриальную ДНК неандертальца (небольшого размера молекулы ДНК, содержащиеся в митохондриях и передающиеся по материнской линии) и заявил о полном отсутствии смешения. Но когда спустя несколько лет он же секвенировал остальной геном неандертальца, то сменил тезис на противоположный: выяснилось, что около 2% генома современного человека имеет неандертальское происхождение. Дальнейшие исследования показали, что эта доля варьирует от 1 до 4% по Евразии, но практически отсутствует у населения Африки южнее Сахары. И неудивительно — такое генетическое наследство сапиенсы могли получить только при скрещивании с неандертальцами, а поскольку межвидовая метисация происходила после выхода человека из Африки, то у современных африканцев нет её следов.

После того как генетики научились находить последовательности неандертальской ДНК, спрятанные в современном геноме, выяснилось, что у разных людей неандертальское генетическое наследство различно как по размеру, так и по набору фрагментов ДНК. Генетики из Вашингтонского университета (Vernot, Akey, 2014) подсчитали его в 665 геномах жителей Европы и Восточной Азии и выяснили: суммарно в их геномах спрятано около 600 миллионов нуклеотидов, унаследованных от неандертальцев, что составляет около 20% неандертальского генома. Иными словами, пятая часть генома неандертальцев не исчезла окончательно, а живёт в современном человечестве. Хотя у каждого отдельного человека, как сказано выше, доля неандертальской ДНК составляет от 1 до 4%. Интересно и то, что в азиатских популяциях её чуть больше, чем в европейских. Учёные объясняют это вторым потоком неандертальских генов, затронувшим только Восточную Азию.

Где и когда сапиенсы плодотворно общались с неандертальцами? Первоначально считали, что это случилось вскоре после выхода первых людей из Африки, то есть 50—60 тыс. лет назад, на Ближнем Востоке, где мигранты сделали остановку. Но открытие 2015 года показало, что не только там и не только тогда. При исследовании ДНК древнейшего человека современного вида на территории Европы (в Румынии) возрастом 37—42 тыс. лет обнаружилось, что в ДНК индивида Oase 1 число неандертальских фрагментов существенно больше, чем в других, столь же древних, найденных на территории России: в образце Костенки-14 (Воронежская область) возрастом 36—39 тыс. лет, в образце из Усть-Ишима близ Байкала возрастом 42—43 тыс. лет и в нескольких других. В геноме Oase 1 неандертальская ДНК составила более 7%, причём её фрагменты достигали значительной длины. Это говорит о недавней метисации с неандертальцами, так как с течением времени длинные фрагменты становятся короткими. Авторы подсчитали, что предки Oase 1 скрещивались с неандертальцами всего за четыре—шесть поколений до его рождения. Очевидно, уже в Европе. Правда, след от этой недавней метисации не дошёл до нашего времени: учёные не обнаружили генетического сходства Oase 1 с последующими популяциями.

О денисовце — ещё одном виде человека, жившем в Евразии одновременно с сапиенсами и неандертальцами, — мир узнал после того, как тот же Сванте Паабо прочитал сначала митохондриальный, а потом и ядерный геном из фаланги пальца, найденной в 2008 году в Денисовой пещере на Алтае. Эта история замечательна тем, что денисовца определили как отдельный вид человека исключительно по ДНК. Можно сказать, что на сегодняшний день о денисовце мы не знаем ничего, кроме его генома (костные фрагменты ничтожны: помимо первоначальной фаланги пальца позже найдено ещё два зуба). Сейчас генетики изучили ДНК из всех трёх фрагментов и узнали, что денисовцы жили в той пещере от 100 до 50 тыс. лет назад, возможно, в какой-то период делили её с неандертальцами, а возможно, заселялись в неё дважды (Sawyer, 2015). Жили они, похоже, почти по всей Азии, а особенно большой след оставили в геномах жителей островов у юго-восточной оконечности Азии; так, в Меланезии он достигает 2—4%.

Заселение Европы

В последние годы появилось множество работ, в которых с помощью анализа древней ДНК показано, как человечество осваивало Европу, какие группы внесли свой вклад в генофонд современного населения. В самых общих чертах картина такова. После того как человек современного типа достиг Европы (от 40 до 35 тыс. лет назад), группы охотников-собирателей обитали в разных её частях и практически не смешивались друг с другом. Последний факт получен как раз генетиками: образцы древней ДНК охотников-собирателей верхнего палеолита показывают, что их популяции в разных регионах были генетически очень различны.

В неолите произошла революция — люди перешли от присваивающего хозяйства к производящему: от охоты и собирательства к земледелию и скотоводству. Она радикально поменяла образ жизни наших предков и стимулировала развитие технологий. Земледелие, возникнув впервые около VII тысячелетия до н. э. на Ближнем Востоке, в течение последующих тысячелетий распространилось в Европу. Один из главных вопросов, которые пытаются решить специалисты разных наук, состоит в том, привело ли оно к смене населения. Существуют две гипотезы: культурная диффузия, когда происходит передача навыков земледелия между соседними группами населения, а сами они практически остаются на месте, и демическая диффузия, когда технологии передаются вместе с мигрирующим населением.

Определить, была ли миграция (то есть поток генов), — дело генетиков. Сначала они изучили древнюю митохондриальную ДНК (мтДНК) из европейской неолитической популяции (культуры линейно-ленточной керамики) и показали её сходство с мтДНК населения Ближнего Востока. Это свидетельствует, что ближневосточные земледельцы действительно мигрировали в Европу, принеся с собой технологии выращивания культурных растений. Вывод о ближневосточной неолитической миграции подтвердился и тогда, когда генетики смогли секвенировать полный ядерный геном из древних образцов. Авторы статьи в «Nature» под руководством ведущих специалистов по древней ДНК Дэвида Райха (Гарвардская медицинская школа в Бостоне) и Йоханнеса Краузе (Институт истории человечества Общества Макса Планка в Йене) изучали, из каких групп населения формировался генофонд Европы. По их гипотезе, основными источниками стали три древние популяции. Первая — европейские охотники-собиратели (жившие в Европе со времён палеолита), вторая — ближневосточные земледельцы (которые мигрировали в Европу и смешались с местными аборигенами), третью условно назвали «древними североевразийцами» (тоже охотники-собиратели, впервые генетически изученные в образце со стоянки Мальта в Сибири).

Чем больше древних геномов стало возможно прочитать, тем точнее становилась эта картина. Когда число древних образцов ДНК достигло 94 (от палеолита до железного века), та же команда опубликовала в «Nature» очередную статью, в которой описала генетический след другой большой миграции в Европу. Эта миграция в позднем неолите и начале бронзового века происходила из причерноморско-каспийских степей. Авторы связывают её с населением археологической ямной культуры, жившим в этих местах 5 тыс. лет назад. (Культура получила название из-за обычая погребения умерших в открытых ямах.) «Степной» генетический компонент они выявили в западноевропейских популяциях бронзового века, в населении культуры шнуровой керамики.

Итак, две большие миграционные волны сыграли ведущую роль в предыстории Европы. Первая — в раннем неолите — принесла в Европу гены первых земледельцев с Ближнего Востока, вторая — в позднем неолите — гены степняков ямной культуры. Но если первая — неолитическая миграция с Ближнего Востока — признаётся практически всеми специалистами и в этом генетики совпадают с археологами, то по поводу степной миграции бронзового века ломается много копий. Здесь с генетиками не согласны как археологи, так и лингвисты. Большинство археологов (в частности, Лев Самуилович Клейн) не находят археологических подтверждений миграции «ямников» и не усматривают связи их культуры с европейской культурой шнуровой керамики. Лингвисты же выступают против попыток авторов связать эту миграцию с распространением в Европу индоевропейских языков, поскольку место возникновения и пути распространения этой самой многочисленной семьи языков до сих пор представляют предмет бурных дискуссий.

Да и сами генетики сейчас с осторожностью относятся к выводу о миграции ямной культуры. Например, хотя в нескольких древних образцах «ямников» обнаружена гаплогруппа (вариант) Y-хромосомы R1b (который обычно ассоциируется с Европой), более подробный анализ, выполненный в ИОГен РАН, показал, что это не западная, а восточная ветвь R1b, так что в современной Европе искать её не стоит. С осторожностью говорит об этом и один из авторов работы Вольфганг Хаак: «Возможно, правильнее назвать этот генетический след “похожим на ямную степным предковым компонентом”».

Другая группа исследователей под руководством Эске Виллерслева (Eske Willerslev из Центра географической генетики Музея естественной истории университета Копенгагена, Дания), прочитав уже более сотни древних геномов, рассмотрела период бронзового века. Эта эпоха (от 3 до 1 тыс. лет назад), когда камень уступает место металлу, сопровождается радикальными культурными и социальными изменениями в жизни людей. Они касаются не только хозяйственного уклада — возникает новое понимание имущественных отношений, семьи и личности. И снова встаёт тот же вопрос, что и с неолитом: была ли это циркуляция людей или идей?

Мортен Аллентофт (Morten E. Allentoft) и его коллеги (также из центра географической генетики музея естественной истории университета Копенгагена) склоняются к первой версии. Миграции (циркуляции людей) в бронзовом веке были очень интенсивными, и именно в этом периоде, через сложные процессы экспансии, смешения и замещения популяций, сформировались основные археологические культуры. Авторы также указывают на миграцию ямной культуры из степей, генетический след которой они находят в ряде европейских культур. Более того, они проследили миграцию ямной культуры в Сибирь, где она дала начало афанасьевской культуре Алтае-Саянского региона.

Надо сказать, что в работах разных генетиков много противоречий, которые не всегда можно объяснить. Более того, иногда одна и та же команда в последующих публикациях значительно перерабатывает свои же собственные выводы, сделанные ранее. Но процесс идёт, и по мере того как прочитанных древних геномов будет больше, а качество прочтения — надёжнее, картина реконструкции заселения Евразии должна становиться точнее.

Светлая кожа, молоко и голубые глаза

По древней ДНК можно проследить и то, как у наших предков изменялись признаки внешности, строение тела или обмен веществ. В процессе расселения по Евразии человек попадал в новые условия обитания, в которых какие-то признаки оказывались полезными. Генетические варианты, отвечающие за эти полезные признаки, повышают приспособляемость индивида и поддерживаются естественным отбором. При этом частота генетических вариантов (аллелей) повышается и признаки распространяются в популяции.

Исследование естественного отбора, происходившего в человеческих популяциях за 8 тыс. лет, по древней ДНК предприняла уже упомянутая команда Дэвида Райха. В геномах 83 индивидов, от палеолита до бронзы, генетики изучили однонуклеотидный полиморфизм (SNP, «снипы») — участки, где происходит замена одного нуклеотида другим. Из 400 тыс. изменчивых участков они выбрали те, которые оказывают влияние на синтез белков и, следовательно, на те или иные признаки. Для каждой такой функционально важной SNP-мутации оценили её частоту в древних и современных популяциях и проверили, поддерживалась ли эта мутация естественным отбором. Таких полезных мутаций, которые помогали выживать нашим предкам, оказалось несколько.

Одна из них находится в составе гена лактазы (фермента, расщепляющего молочный сахар — лактозу). Эта мутация обеспечивает синтез лактозы в течение всей жизни, поэтому обладающие ею взрослые могут пить молоко, а обладатели исходного варианта гена без мутации могут пить молоко только в младенчестве. Так вот, мутантный ген исследователи не нашли в раннем неолите, не нашли даже у скотоводов ямной культуры, несмотря на то что те использовали рогатый скот. Получается, что мутация впервые распространилась в популяции примерно 4 тыс. лет назад, а значит, люди стали способны употреблять в пищу молоко далеко не сразу после того, как одомашнили животных. Но эта привычка оказалась настолько полезной, что возникшая мутация распространялась очень быстро и сегодня имеется у 70% европейцев.

Другой признак — светлая кожа, которую обеспечивают варианты (аллели) двух генов, влияющих на пигментацию. У западноевропейских охотников-собирателей таких аллелей не было вовсе или же они были очень редки, так что, вероятно, кожа у них была довольно тёмной. Анализ показал, что первый аллель уже в раннем неолите достигает высокой частоты, а второй в то время только возникает, но быстро распространяется. У современных европейцев эти светлокожие варианты встречаются почти поголовно, за исключением испанцев.

В европейских популяциях бронзового века достигает заметной частоты и аллель, отвечающий за голубой цвет глаз. Но у него сильный географический градиент — высокая частота на севере и низкая на юге. Это понятно, так как светлый цвет радужки на юге неблагоприятен: он не защищает сетчатку от интенсивного солнечного излучения.

Некоторые самые полезные гены пришли из «параллельного человечества». Например, ген, обеспечивающий выживание на большой высоте (в условиях недостатка кислорода) у современных жителей Тибета, был позаимствован ими у денисовцев. Есть данные, что ген, позволяющий эскимосам эффективно согреваться при метаболизме жиров, тоже получен ими от денисовцев. Постепенно накапливается всё больше примеров того, что Homo sapiens, выйдя из Африки в Евразию и столкнувшись с новыми для себя климатическими условиями, воспользовался для адаптации генами, полученными от смешения с денисовцами и неандертальцами, которые к тому времени уже многие десятки тысячелетий обитали в Евразии и успели приспособиться к самым разным климатическим зонам.

Это лишь несколько примеров открытий, которые сделаны благодаря палеоДНК. Кто знает, какие ещё события прошлого генетикам удастся прочитать по ДНК? Обрывки двойных спиралей, разбросанные по планете, хранят информацию наподобие бортовых «чёрных ящиков» в ожидании экспертов, способных её точно прочитать и правильно понять.

Истоки генетики человека. Личный взгляд

Два новых важных открытия, сделанных в 1949 году, служат вехами в развитии ранней генетики человека. Джеймс В. Нил описал серповидно-клеточную анемию как аутосомно-рецессивный признак [19], а четыре месяца спустя в том же томе Science Линус Полинг определил это заболевание как «молекулярное» заболевание [20]. В 1949 году JBS Haldane оценил частоту мутаций у людей на основе анализа семи человеческих болезней примерно как 4 × 10 –5 [21].Также в 1949 г. в публикации под названием «Болезни и эволюция» Дж. Б. С. Холдейн рассматривал инфекционные заболевания как потенциально «агент естественного отбора» у человека [22].

Другая знаменательная статья 1949 года описала случайное открытие цитологически видимой структуры в ядре нейронов кошек, но не самцов [23]. Впоследствии названный тельцем Барра, позже Х-хроматином, это в конечном итоге привело к принципу инактивации Х-хромосомы [24]. Приведенные выше примеры представляют собой сдвиг в парадигме научного прогресса, как постулировал Кун [25].Согласно этой теории, наука прогрессирует не только по мере непрерывного накопления знаний, но также по периодам новой парадигмы, задавая совершенно новые вопросы в новом контексте [26].

По дополнительным причинам 1949 год можно считать переломным моментом, с которого началась современная генетика человека. В 1949 году был основан Американский журнал генетики человека, через год после основания Американского общества генетики человека (ASHG). Курт Стерн (1902–1981), один из ведущих генетиков между 1923 и 1970 годами, опубликовал первый учебник в этой области, Принципы генетики человека [27].

Первые две встречи ASHG состоялись в сентябре 1948 г. в Вашингтоне, округ Колумбия, и в декабре 1949 г. в Нью-Йорке, оба под руководством Г. Дж. Мюллера в качестве президента. Обращение Мюллера к президенту, представленное на втором ежегодном собрании ASHG в 1949 году, было озаглавлено «Наш груз мутаций» [28]. В основном это касалось последствий мутаций у людей на популяционном уровне.

В 1940 году в Великобритании появился учебник под названием Введение в медицинскую генетику Фрейзера Робертса [29].Это был первый учебник по медицинской генетике, и единственный за много лет.

1949 год также примечателен для генетики человека в послевоенной Германии (Расширенный текст № 2 в Дополн. Мат.).

Ранние достижения

Переход от общей генетики к генетике человека характеризуется осознанием медицинских аспектов. Недавно обнаруженные хромосомные аномалии, наследственные метаболические дефекты и молекулярные технологии привели к определению новых заболеваний человека, вызванных различными генетическими причинами.Генетика человека включает медицинской генетики , посвященной всем ее медицинским аспектам, и клинической генетики, , практике диагностики и лечения генетических нарушений. McKusick в 1993 году заявил, что клиническая генетика зародилась в 1959 году, когда человеческая цитогенетика и биохимическая генетика превратились в основные объекты исследований и их медицинских приложений [30]. Термин геномика , производный от генома (введен Винклером в 1920 г.), был введен в 1987 г. [31].Это относится не только ко всем генам, но и к молекулам, регулирующим их функции и ядерные структуры.

Европейское общество генетиков человека (ESHG) было основано на Третьем Международном конгрессе генетиков человека в 1966 году в Чикаго, в нем присутствовали автор этого обзора и Альбер де ла Шапель. Его первое ежегодное собрание состоялось в 1968 году в Париже.

Хромосомы

Генетика человека – это наука, основанная на теории, но она также во многом зависит от достижений в методах исследования.Вероятно, наиболее важным отдельным вкладом в развитие современной генетики человека был вклад цитогенетики в 1959 г. [32,33,34,35,36]. Сначала отдельные хромосомы в митозе еще не могли быть идентифицированы индивидуально, за исключением нескольких пар хромосом (расширенный текст № 3 в Supp. Mat.). Новые методы культивирования клеток и улучшенные препараты митотических хромосом для светового микроскопического анализа непосредственно привели к признанию в 1959/60 г., что некоторые заболевания человека являются результатом определенных аберраций в количестве или структуре хромосом (трисомии 21, 18, 13; частичные хромосомные делеции или дупликации ).Поскольку каждая аберрация была связана с отдельным фенотипом, можно было определить взаимосвязь между генотипом и фенотипом. В 1959 году было показано, что люди без Y-хромосомы были женщинами [37], тогда как люди с Y-хромосомой были мужчинами, независимо от количества присутствующих X-хромосом [38]. Это был первый шаг к определению основ определения пола млекопитающих. В 1960-х и 1970-х годах стало очевидно, что смерть плода часто вызывается хромосомными аберрациями, которые не наблюдаются у новорожденных.Хотя хромосомы в метафазе были описаны еще в 1879 году, правильное количество человеческих хромосом не было установлено до 1956 года (расширенный текст № 4 в Supp. Mat.).

Клеточные культуры и биохимические дефекты

С 1960-х годов культивируемые клетки стали широко использоваться для исследования моногенных заболеваний человека (генетика соматических клеток). Клетки, гомозиготные по генетическому дефекту, можно было отличить от гетерозиготных клеток. Слитые гомозиготные клетки от разных пациентов (клеточные гибриды) могут приводить к нормальному клеточному фенотипу, доказывая, что рассматриваемое заболевание является генетически гетерогенным.Биохимические анализы начали определять наследственные метаболические заболевания человека, такие как аминокислотные нарушения, лизосомные болезни накопления и другие, на уровне фенотипа и генотипа. Пренатальная генетическая диагностика была введена в конце 1960-х годов.

Молекулярный прогресс

Начиная с 1974 г. ДНК можно было анализировать, применяя новые методы рекомбинантной ДНК, прямо или косвенно, с использованием связанных полиморфных ДНК-маркеров. Новые методы секвенирования нуклеотидов ДНК в 1977 г. и амплификации небольших количеств ДНК в 1985 г. (ПЦР) привели к точному генетическому диагнозу с правильной оценкой генетического риска в данной семье.Молекулярная цитогенетика была введена вскоре после 1985 г. Это позволило анализировать митотические хромосомы путем гибридизации ДНК in situ. Стали видны субмикроскопические хромосомные изменения (менее 4 миллионов пар оснований ДНК). Новые автоматизированные методы массового параллельного секвенирования ДНК («следующее поколение»), представленные в 2005 году, позволили секвенировать ДНК большого числа людей и опухолевых клеток при относительно низкой стоимости [2, 4]. Возможны и другие новые подходы: полногеномные ассоциативные исследования (GWAS), секвенирование экзома, полногеномное секвенирование и другие.

Генетика в медицине

Примерно с 1960 года генетика включала в себя ее медицинские аспекты. МакКьюсик в 1992 г. рассмотрел развитие генетики человека с Первого Международного конгресса по генетике человека в 1956 г. в Копенгагене до 1991 г. [39]. Он отметил, что к 1992 году генетика человека стала «медицинской, узкоспециализированной, профессионализированной, молекулярной, ориентированной на потребителя, коммерциализированной». Систематическая генетическая диагностика и генетическое консультирование стали частью ухода за пациентами [40]. Американский совет по медицинской генетике был основан в 1979 году, Американский колледж медицинской генетики – в 1992 году.

Подробности ранних стадий развития генетики человека рассмотрены McKusick [40], Polani [41], Harper [42, 43], Harper et al. [44]; McKusick & Harper и Childs & Pyeritz [45, 46], а в последнее время Clausnitzer et al. [4]. Чайлдс в 1999 и 2013 годах [47, 48] обратил внимание на два взгляда на болезни: классификация болезней различается в медицине и в медицинской генетике человека. В медицине это в основном основано на фенотипе, то есть клиническом проявлении, тогда как система генетической классификации основана на генотипе, т.е.е., различные типы мутаций или других структурных перестроек. В таблице 1 перечислены основные генетические особенности генетических нарушений, впервые описанных по их фенотипам с 1949 года. Примечательно, что многие из этих распознаваемых фенотипов не были описаны ранее, например, трисомия 18, тогда как фенотип трисомии 13 был описан в 1657 году. (Томас Бартолин, «Monstrum sine oculis»). Большинство расстройств, перечисленных в таблице 1, можно классифицировать по их генотипам, а не по фенотипам.Их классификация основана на различных патогенных причинах, таких как нарушение функций в структуре генома, регуляция хроматина, клеточные рецепторы, факторы транскрипции, пути передачи сигналов, импринтинг и другие (другие примеры генетической классификации болезней см. В расширенном тексте No 5 в Supp. Мат.).

Таблица 1 Примеры новых генетических нарушений, описанных в 1949–2009 гг.

В таблице S1 приведены примеры основных достижений в области генетики человека за период с 1949 по 2020 годы. Критерии отбора основаны на том, как каждая запись воспринималась в литературе, и на личных наблюдениях с 1963 года.В левом столбце представлены достижения, непосредственно связанные с генетикой человека, а в правом столбце – косвенный вклад в генетику человека.

Нигде огромный прогресс в медицинских аспектах генетики человека ( медицинская генетика ), особенно в отношении моногенных заболеваний, не был более заметным, чем в Менделевской наследственности человека. Каталог генов человека и генетических заболеваний (рис. S1). Впервые он был создан в 1966 году Виктором МакКусиком (1921–2008) в Университете Джона Хопкинса в Балтиморе и выдержал 12 печатных изданий (1966–1998).С тех пор он поддерживается в сети как Online Mendelian Inheritance in Man (ссылка [49], он-лайн свободно доступен на OMIM: www.ncbi.nlm.nih.gov/omim). CF Fraser и H Harris в 1956 году независимо установили генетическую гетерогенность как основной принцип медицинской генетики [50,51,52,53]. Scriver в 1999 г. [54] впервые продемонстрировал, что модифицирующие гены влияют на фенотип, тяжесть и течение болезни при моногенных расстройствах [55,56,57]. Важный сдвиг парадигмы в генетике произошел, когда была введена концепция генетического консультирования (расширенный текст № 6 в Supp.Мат.).

Достижения в области общей генетики, применявшиеся к людям до 1949 г.

До 1949 г. ни одно из многих открытий в области генетики не могло быть получено из прямых наблюдений на людях. Как правило, достижения в области генетики не рассматривались в медицинском контексте с уходом за пациентами. Знания о генетических нарушениях человека были нацелены на популяционный уровень, а не индивидуально для пациентов и их семей. Моногенные менделевские расстройства рассматривались как слишком редкие, чтобы иметь отношение к медицинским приложениям и уходу за пациентами.Сложные расстройства многофакторной этиологии еще не выявили своей генетической составляющей. Некоторые из ранних генетических исследований на людях были направлены на генетику нормальных черт, таких как рост, цвет глаз, кожа, волосы, умственные способности и тому подобное. Они пришли к ошибочным выводам, потому что лежащие в основе генетические свойства не так просты, как предполагалось в то время. Несколько президентов Американского общества генетики человека и другие размышляли о состоянии генетики человека до 1949 г. (Расширенный текст № 7 в Прилож.Мат.).

Несколько более ранних попыток связали генетические знания с людьми. Нил в 1939 г. инициировал семинар по генетике человека вместе с Куртом Стерном (Расширенный текст № 8 в Дополн. Мат.). В 1940 году в Великобритании появился учебник Фрейзера Робертса под названием Введение в медицинскую генетику [29]. Это был первый учебник по медицинской генетике, и единственный за много лет (Расширенный текст № 9 в Дополн. Мат.). В Германии в 1923 г. 500-страничный учебник под названием «Наука о наследственности человека и расовая гигиена» выдержал пять изданий до 1940 г. (Расширенный текст № 10 в Прилож.Мат.).

В 1934 году А. Фёллинг описал фенилкетонурию (OMIM 261600) как причину умственной отсталости. После того, как Г.А. Джервис обнаружил дефект фермента в 1947 году, а Х. Бикель в 1953 году обрисовал подход к диетической терапии, Р. Гатри в 1962 году заложил основу для популяционного скрининга новорожденных для ранней диагностики и эффективной терапии. Сегодня большое количество наследственных нарушений обмена веществ может быть выявлено у новорожденных еще до их клинического проявления.

Однако в целом достижения генетики не рассматривались по отношению к медицине.Это потребовало бы смены парадигмы, чего в то время не произошло. Грубое заблуждение в применении генетических соображений к людям в 1920-х и 1930-х годах было Евгеника (Расширенный текст № 11 в Дополнении Матем.).

Предыдущие идеи

Здесь можно процитировать три замечательных исключения из ранних генетических представлений о людях: Уильяма Бейтсона, Арчибальда Э. Гаррода и Теодора Бовери. Их можно считать предшественниками генетики человека. Уильям Бейтсон (1861–1926) в Кембридже в его Принципах наследственности в 1913 году [12] описал несколько родословных людей с аутосомно-доминантным, рецессивным и X-сцепленным наследованием (стр.203–234). Бейтсон заявляет на странице 233: «Точно так же, когда мы обнаруживаем, что такое состояние, как пигментный ретинит, иногда возникает тем или иным образом, мы, возможно, можем ожидать, что более полное знание фактов покажет, что более одного патологического состояния может быть включено в категорию. одноименное »[12]. Таким образом, Бейтсон признал генетическую гетерогенность более чем за 40 лет до того, как К. Фрейзер и Х. Харрис в 1956 году независимо установили ее в качестве основного принципа в генетике человека (см. Выше). Другими примерами ранних описаний менделевского наследования болезней человека являются наследственные биохимические дефекты, описанные Арчибальдом Гарродом как «врожденные ошибки метаболизма» [58,59,60] или брахидактилия типа A1 (OMIM 112500) У.К. Фараби в докторской диссертации, опубликованной в 1905 г., обзор Haws & McKusick в 1963 г. [61] и Bateson, 1913 г., стр. 210–216 [12].

Арчибальд Э. Гаррод (1857–1936) в больнице на Грейт-Орманд-стрит в Лондоне признал генетическую индивидуальность человека. В письме к Бейтсону от 11 января 1902 года Гаррод писал: «Я считаю, что нет двух людей, абсолютно одинаковых химически, а не только структурно (ссылка [60], Bearn, 1993, стр. 61). В своей прозорливой монографии Врожденные факторы болезни от 1931 года Гаррод считал важным предрасположенность к болезням [47, 48, 60]. Замечательная идея, указывающая на важность генетики в человеческих болезнях, содержится в Нобелевской лекции Томаса Моргана в 1934 г., Отношение генетики к физиологии и медицине : «… учитывая нынешнее отношение медицины и доминирующее место конституционных исследований. , роль внутренних наследственных факторов для здоровья и болезней предстает в еще более ясном свете.Таким образом, для общего понимания болезней, для профилактической медицины и для лечения болезней наследственные исследования приобретают еще большее значение »(цитируется Bearn, 1993, ссылка [60], стр. 193).

Третий пример – Теодор Бовери (1862–1915) в Вюрцбурге. К 1902 году он признал индивидуальность хромосом [62]. Впоследствии Бовери связал изменения в хромосомах с причинами рака [63, 64]. Однако прошло более четырех десятилетий, пока в 1960 г. не была описана филадельфийская хромосома при хроническом миелолейкозе [65, 66].Гипотеза «Один ген – один фермент», предложенная Джорджем Бидлом в 1941 году, могла бы стать краеугольным камнем биохимической генетики человека. Бидл упомянул Гаррода в своей Нобелевской лекции 1958 года (цитируется Беарном, 1993, ссылка [60], стр. 150).

Разнообразие современной генетики человека

Современная генетика человека развивалась в разных направлениях, в основном на основе различных методов исследования, хотя в исследованиях она никоим образом не ограничивается Homo sapiens . Сегодня он включает в себя несколько подразделов геномики (например,g., протеомика, эпигеномика и др.), молекулярная генетика, генетика и -геномика опухолей, фармакогенетика и -геномика, иммуногенетика, эпигенетика, цитогенетика, генетика соматических клеток, биохимическая генетика, популяционная генетика, эволюционные основы причин нарушений, биоинформатика и другие . Это подробно рассмотрено в двух современных многотомных онлайн-учебниках [67, 68]. Никакая генетика или геномика позвоночных не изучена лучше, чем человеческая. Тем не менее, генетика человека не является установленной программой обучения на факультетах медицины или биологии.Скорее, чтобы стать генетиком человека, необходимо изучить медицину или фундаментальные науки и пройти примерно пять лет формального обучения в аспирантуре. Таким образом, генетики человека представляют собой либо медицинскую, либо немедицинскую фундаментальную науку. Эта двойная структура, состоящая из медицинских и биологических дисциплин, делает генетику человека уникальной среди медицинских специальностей, как подробно изложил Чайлдс [47, 48].

генетика | История, биология, хронология и факты

Генетика , изучение наследственности в целом и генов в частности.Генетика является одним из центральных столпов биологии и пересекается со многими другими областями, такими как сельское хозяйство, медицина и биотехнология.

Популярные вопросы

Что такое генетика?

Генетика – это изучение наследственности в целом и генов в частности. Генетика является одним из центральных столпов биологии и пересекается со многими другими областями, такими как сельское хозяйство, медицина и биотехнология.

Является ли интеллект генетическим?

Интеллект – очень сложная человеческая черта, генетика которой некоторое время была предметом споров.Интеллект, даже примерно измеренный с помощью различных когнитивных тестов, показывает значительный вклад окружающей среды.

Как проводится генетическое тестирование?

Генетическое тестирование обычно проводится только после рассмотрения истории болезни, медицинского осмотра и построения семейной родословной, документирующей семейные генетические заболевания. Сами генетические тесты проводятся с использованием химических, радиологических, гистопатологических и электродиагностических процедур. Генетическое тестирование может включать цитогенетические анализы для исследования хромосом, молекулярные анализы для исследования генов и ДНК или биохимические анализы для исследования ферментов, гормонов или аминокислот.

С самого начала цивилизации человечество осознало влияние наследственности и применило ее принципы для улучшения сельскохозяйственных культур и домашних животных. Например, вавилонская табличка, возраст которой превышает 6000 лет, показывает родословные лошадей и указывает возможные унаследованные характеристики. Другие старые резные фигурки показывают перекрестное опыление финиковых пальм. Однако большинство механизмов наследственности оставались загадкой до 19 века, когда зародилась генетика как систематическая наука.

Генетика возникла из идентификации генов, фундаментальных единиц, ответственных за наследственность. Генетику можно определить как изучение генов на всех уровнях, включая то, как они действуют в клетке и передаются от родителей к потомству. Современная генетика фокусируется на химическом веществе, из которого состоят гены, называемом дезоксирибонуклеиновой кислотой или ДНК, и на способах его воздействия на химические реакции, которые составляют жизненные процессы внутри клетки.Действие гена зависит от взаимодействия с окружающей средой. Зеленые растения, например, имеют гены, содержащие информацию, необходимую для синтеза фотосинтетического пигмента хлорофилла, который придает им зеленый цвет. Хлорофилл синтезируется в среде, содержащей свет, потому что ген хлорофилла экспрессируется только при взаимодействии со светом. Если растение помещено в темную среду, синтез хлорофилла прекращается, потому что ген больше не экспрессируется.

Генетика как научная дисциплина возникла в результате работ Грегора Менделя в середине XIX века.Мендель подозревал, что черты наследуются как дискретные единицы, и, хотя он ничего не знал о физической или химической природе генов в то время, его единицы стали основой для развития современного понимания наследственности. Все современные исследования в области генетики восходят к открытию Менделем законов, регулирующих наследование признаков. Слово генетика было введено в 1905 году английским биологом Уильямом Бейтсоном, который был одним из первооткрывателей работ Менделя и стал поборником принципов Менделя наследования.

Получите подписку Britannica Premium и получите доступ к эксклюзивному контенту. Подпишитесь сейчас

Историческая справка

Древние теории пангенезиса и крови в наследственности

Хотя научные доказательства закономерностей генетической наследственности не появлялись до работы Менделя, история показывает, что человечество должно было интересоваться наследственностью задолго до зарождения цивилизации. В первую очередь любопытство должно было быть основано на семейных сходствах людей, таких как сходство в строении тела, голосе, походке и жестах.Такие представления сыграли важную роль в создании семейных и королевских династий. Ранние кочевые племена интересовались качествами животных, которых они разводили и приручили, и, несомненно, разводили их выборочно. Первые поселения людей, которые практиковали земледелие, по-видимому, выбрали культурные растения с благоприятными качествами. На древних гробницах изображены племенные родословные скаковых лошадей, содержащие четкие изображения наследования нескольких отличительных физических черт лошадей. Несмотря на этот интерес, первые зарегистрированные предположения о наследственности не существовали до времен древних греков; некоторые аспекты их идей до сих пор считаются актуальными.

Гиппократ ( ок. 460– ок. 375 до н. Э.), Известный как отец медицины, верил в наследование приобретенных характеристик и, чтобы объяснить это, он разработал гипотезу, известную как пангенезис. Он предположил, что все органы тела родителей испускают невидимые «семена», которые были подобны миниатюрным строительным компонентам и передавались во время полового акта, собираясь заново в утробе матери, чтобы сформировать ребенка.

Аристотель (384–322 до н. Э.) Подчеркивал важность крови в наследственности.Он думал, что кровь является генеративным материалом для построения всех частей тела взрослого человека, и он полагал, что кровь является основой для передачи этой воспроизводящей силы следующему поколению. Фактически, он считал, что мужское семя – это очищенная кровь, а менструальная кровь женщины – ее эквивалент семени. Эти мужские и женские вклады соединились в утробе матери, чтобы произвести на свет ребенка. Кровь содержала какой-то тип наследственных сущностей, но он считал, что ребенок будет развиваться под влиянием этих сущностей, а не создаваться из самих сущностей.

Идеи Аристотеля о роли крови в деторождении, вероятно, явились источником все еще распространенного представления о том, что кровь каким-то образом участвует в наследственности. Сегодня люди все еще говорят об определенных чертах как о «кровных», «кровных линиях» и «кровных узах». Греческая модель наследования, в которой использовалось бесчисленное множество субстанций, отличалась от модели менделевской. Идея Менделя заключалась в том, что явные различия между людьми определяются различиями в единичных, но мощных наследственных факторах.Эти единичные наследственные факторы были идентифицированы как гены. Копии генов передаются через сперматозоиды и яйцеклетки и направляют развитие потомства. Гены также несут ответственность за воспроизведение отличительных черт обоих родителей, которые видны у их детей.

За два тысячелетия между жизнями Аристотеля и Менделя было зафиксировано несколько новых идей о природе наследственности. В 17-18 веках появилась идея преформации. Ученые, использующие недавно разработанные микроскопы, вообразили, что могут видеть миниатюрные копии человеческих существ внутри головок сперматозоидов.Французский биолог Жан-Батист Ламарк использовал идею «наследования приобретенных признаков» не как объяснение наследственности, а как модель эволюции. Он жил в то время, когда неподвижность видов считалась само собой разумеющейся, однако он утверждал, что эта неподвижность обнаруживается только в постоянной среде. Он провозгласил закон использования и неиспользования, который гласит, что, когда определенные органы становятся особенно развитыми в результате некоторой потребности в окружающей среде, тогда это состояние развития является наследственным и может передаваться потомству.Он считал, что таким образом на протяжении многих поколений жирафы могли возникнуть из оленеподобных животных, которым приходилось вытягивать шеи, чтобы дотянуться до высоких листьев на деревьях.

Британский натуралист Альфред Рассел Уоллес первоначально постулировал теорию эволюции путем естественного отбора. Однако наблюдения Чарльза Дарвина во время его кругосветного плавания на борту HMS Beagle (1831–36) предоставили доказательства естественного отбора и его предположение о том, что люди и животные имеют общее происхождение.Многие ученые в то время верили в наследственный механизм, который был версией древнегреческой идеи пангенезиса, и идеи Дарвина, похоже, не соответствовали теории наследственности, которая возникла в результате экспериментов Менделя.

Геном: открытие кода жизни | Евгеника2

1865 г. | Грегор Мендель, отец современной генетики, представляет свои исследования экспериментов по гибридизации растений.

1869 г. | Фридрих Мишер идентифицирует нуклеин, ДНК с ассоциированными белками, из ядер клеток.

1952 г. | Розалинда Франклин создает фотографию 51, на которой виден характерный узор, указывающий на спиралевидную форму ДНК.

1953 г. | Джеймс Уотсон и Фрэнсис Крик открывают двойную спиральную структуру ДНК

1961 г. | Маршалл Ниренберг раскрыл генетический код синтеза белка

1977 г. | Фредерик Сэнгер разрабатывает технику быстрого секвенирования ДНК

1983 г. | Первое выявленное генетическое заболевание – болезнь Хантингтона.

1983 г. | Изобретение технологии полимеразной цепной реакции (ПЦР) для амплификации ДНК

1989 г. | Обнаружена мутация гена кистозного фиброза

1990 г. | Первые доказательства существования гена BRCA1

1990 г. | Проект “Геном человека” начинается

1995 г. | Haemophilus influenzae становится первой секвенированной бактерией

1996 г. | «Бермудские принципы», разработанные для проекта «Геном человека», свободный доступ к данным

1998 г. | Корпорация Celera Genomics основана для секвенирования генома человека

1999 г. | Хромосома 22 – первая хромосома человека, которую предстоит расшифровать

2000 г. | Сообщается о последовательности генома модельного организма плодовой мухи

2001 г. | Выпущен первый проект генома человека

2002 г. | Мышь стала первым исследовательским организмом среди млекопитающих с расшифрованным геномом

2003 г. | Объявлено о завершении проекта “Геном человека”

Генетика человека: взгляд в зеркало | Геном, биология и эволюция

Кто мы? Откуда мы пришли? как мы сюда попали? На протяжении веков люди искали ответы на эти вопросы, стремясь к мудрости через религию, философию и, в конечном итоге, науку.Эволюционный анализ, опубликованный в журнале Genome Biology and Evolution (GBE) , позволяет нам заглянуть в зеркало и лучше понять себя как вид, приближая нас, как никогда, к поиску ответов на эти давние вопросы.

Первоначальный проект «Геном человека», на завершение которого потребовалось более десяти лет, обошелся почти в 3 миллиарда долларов и потребовал коллективных усилий сотен ученых. С тех пор успехи в технологии секвенирования привели к бурному развитию исследований в области генетики и геномики человека: на сегодняшний день, по оценкам, секвенировано около миллиона геномов человека.Хотя это богатство данных может дать ответ на некоторые из наших самых фундаментальных вопросов, раскрытие его тайн потребовало изобретения новых аналитических и вычислительных методов и интеграции методов и идей из различных биологических наук, включая физиологию, анатомию, медицину, народонаселение. генетика, биоинформатика, вычислительная, молекулярная и эволюционная биология.

Чтобы помочь в решении этой задачи, с момента своего первого выпуска в 2009 году журнал GBE стремился сыграть ключевую роль в этом начинании, публикуя оригинальные исследовательские статьи, письма, обзоры и комментарии, которые вносят вклад в быстро растущий объем литературы по эта тема и стимулировать инновации в этой области.В нашем виртуальном выпуске по генетике человека освещаются некоторые из самых захватывающих исследований, опубликованных в журнале за последние полтора года, и демонстрируется большое разнообразие эволюционных подходов к этому направлению исследований, а также ряд интересных открытий в нашей собственной биологии.

Ключевой областью исследования является определение того, чем люди отличаются от других приматов – другими словами, что делает нас людьми? Несколько исследований, опубликованных за последние 18 месяцев, предполагают, что часть ответа может быть найдена в регуляции транскрипции и изменениях в экспрессии генов.Edsall et al. (2019) оценили различия в доступности хроматина, который влияет на доступ транскрипционного аппарата к ДНК, у пяти приматов, включая человека. Они обнаружили высокий уровень дифференциации между видами, а также классы сайтов, которые различались в зависимости от выбора, геномного местоположения и специфичности клеточного типа. В частности, Swain-Lenz et al. (2019) обнаружили, что различия в доступности хроматина рядом с генами, участвующими в метаболизме липидов, могут служить механистическим объяснением более высоких уровней жира в организме, наблюдаемых у людей по сравнению с другими приматами.Аракава и др. (2019) показали, что специфическое для человека увеличение транскрипции четырех структурных белковых генов может приводить к морфологическим особенностям, характерным для кожи человека, включая увеличение толщины и прочности по сравнению с кожей других приматов. Наконец, каталог белков, участвующих в регуляции транскрипции, проведенный Пердомо-Сабогалом и Новиком (2019), показал, что определенные типы факторов транскрипции связаны с генами, находящимися под положительным отбором, включая те, которые связаны с шизофренией, развитием глаз и фертильностью у людей.

Еще одна интересная область – роль мутации в формировании генома человека и нашей эволюционной истории. Например, ведутся серьезные споры о том, какая часть генома человека подлежит естественному отбору. Утверждалось, что эта доля не может быть слишком большой, иначе люди будут терять физическую форму из-за количества вредных мутаций. Однако Galeota-Sprung et al. (2020) опровергли этот аргумент, показав, что мутационная нагрузка будет терпимой, даже если большая часть генома человека будет подвергаться селекции.Дополнительный анализ Castellano et al. (2020) показали, как скорость рекомбинации, плотность генов и скорость мутаций взаимодействуют, формируя паттерны разнообразия ДНК у людей и других близкородственных гоминин. Исследование Prendergast et al. (2019) далее раскрыли уникальные предубеждения в мутациях, которые происходят в соседних нуклеотидных сайтах у людей, предположив существование различных эволюционных сил, действующих на таких сайтах, и выявив различия в этих силах в человеческих популяциях.

Особенно интересная тема в этой области связана с исследованием генетических различий между человеческими популяциями и их связи с естественной историей этих групп.Например, Harris et al. (2019) обнаружили, что предки коренных американцев несли наследственную, а не производную версию древнего полиморфизма, предшествовавшего расколу с неандертальцами. Этот полиморфизм охватывает гены десатуразы жирных кислот, и, таким образом, люди с коренным американским происхождением могут подвергаться риску низкого уровня питательных веществ, полученных из пищевых жирных кислот омега-3 и омега-6. Jonnalagadda et al. (2019) идентифицировали ряд аллелей, связанных с цветом радужной оболочки и пигментацией кожи у жителей Южной Азии, тогда как Vicuña et al.(2019) обнаружили генетические варианты, которые, возможно, помогли предкам коренных американцев Анд, жившим в пустыне Атакама на севере Чили, адаптироваться к высоким уровням мышьяка в воде. Анализ другой обитающей в пустыне популяции, проведенный Eaaswarkhanth et al. (2020) продемонстрировали доказательства положительного отбора геномной области, охватывающей ген TNKS, у кувейтцев. Поскольку этот ген влияет на метаболические признаки и риск гипертонии, отбор по этому гаплотипу мог дать преимущество кувейтским предкам, жившим в пустыне Аравийского полуострова, но имеет последствия для здоровья их современных потомков.

Действительно, как показали эти исследования, одним из самых больших потенциальных преимуществ этого направления исследований является выявление новых знаний, которые позволяют нам понять здоровье и болезни человека. Reher et al. (2019) обнаружили, что гены основного комплекса гистосовместимости, который помогает иммунной системе распознавать чужеродные вещества, сохраняют более высокий уровень разнообразия, чем другие гены. Это было верно как для архаичных, так и для современных людей, хотя архаичные люди и неандертальцы имели более низкий уровень генетического разнообразия по сравнению с современными людьми.Лин и Гоккумен (2019) охарактеризовали мелкомасштабные структурные вариации в геноме человека и выявили горячие точки, которые были связаны как с адаптивными, так и с биомедицинскими вариантами. Например, они определили горячие точки, связанные с кластерами генов альфа- и бета-гемоглобина, а также с идиопатическим низким ростом. Наконец, исследование Liu et al. (2019) образцов, взятых из одной опухоли пациента с гепатоцеллюлярной карциномой, показали, что митохондриальный геном эволюционировал нейтрально, предоставив доказательства, опровергающие гипотезу о том, что отбор действует на митохондриальную ДНК, способствуя развитию опухоли.

Вместе эта подборка рукописей освещает некоторые из последних открытий и новых подходов в изучении генетики человека, области, которая обещает помочь определить, кто мы как вид, и раскрыть тайны миграции и адаптации человека, которые в противном случае могли бы иметь были потеряны для истории человечества. GBE стремится быть ресурсом для этой захватывающей области исследований и продолжит публиковать новые данные, которые помогут информировать, оспаривать и направлять новые направления исследований.

Цитированная литература

Аракава

N

, и другие.

2019

.

Изменения экспрессии генов структурных белков могут быть связаны с адаптивными характеристиками кожи, специфичными для людей

.

Genome Biol Evol

.

11

(

3

):

613

628

.

Кастеллано

D

Эйр-Уокер

A

Мунк

К.

2020

.

Влияние частоты мутаций и отбора в связанных сайтах на вариации ДНК в геномах человека и других гоминин

.

Genome Biol Evol

.

12

(

1

):

3550

3561

.

Eaaswarkhanth

M

Campelo dos Santos

AL

Gokcumen

O

Аль-Мулла

Ф

Thanaraj

TA.

2020

.

Селекционное сканирование по всему геному в популяции Аравийского полуострова выявляет гаплотип TNKS, связанный с метаболическими признаками и гипертонией

.

Genome Biol Evol

.

12

(

3

):

77

87

.

Эдсалл

LE

, и другие.

2019

.

Оценка различий в доступности хроматина у нескольких видов приматов с использованием подхода совместного моделирования

.

Genome Biol Evol

.

11

(

10

):

3035

3053

.

Галеота-пружина

B

Sniegowski

P

Ewens

W.

2020

.

Мутационная нагрузка и функциональная фракция генома человека

.

Genome Biol Evol

.

12

(

4

):

273

281

.

Харрис

DN

, и другие.

2019

.

Эволюция метаболизма полиненасыщенных жирных кислот гоминина: от Африки к новому миру

.

Genome Biol Evol

.

11

(

5

):

1417

1430

.

Jonnalagadda

M

, и другие.

2019

.

Полногеномное ассоциативное исследование пигментации кожи и радужной оболочки у лиц южноазиатского происхождения

.

Genome Biol Evol

.

11

(

4

):

1066

1076

.

Лин

Y-L

Gokcumen

O.

2019

.

Детализированная характеристика структурных вариаций генома в геноме человека выявляет адаптивные и биомедицинские «горячие точки»

.

Genome Biol Evol

.

11

(

4

):

1136

1151

.

Лю

Q

Лин

Д

Ли

М

Gu

Z

Чжао

Ю.

2019

.

Доказательства нейтральной эволюции митохондриальной ДНК при гепатоцеллюлярной карциноме человека

.

Genome Biol Evol

.

11

(

10

):

2909

2916

.

Perdomo-Sabogal

A

Nowick

K.

2019

.

Генетическая изменчивость факторов регуляции генов человека раскрывает регуляторную роль в местной адаптации и болезнях

.

Genome Biol Evol

.

11

(

8

):

2178

2193

.

Прендергаст

JGD

, и другие.

2019

.

Связанные мутации в соседних нуклеотидах сформировали дифференциацию человеческой популяции и эволюцию белка

.

Genome Biol Evol

.

11

(

3

):

759

775

.

Reher

D

Ключ

FM

Андрес

AM

Келсо

Дж.

2019

.

Разнообразие иммунных генов у древних и современных людей

.

Genome Biol Evol

.

11

(

1

):

232

241

.

Свейн-Ленц

D

Berrio

A

Safi

A

Кроуфорд

GE

Рэй

GA.

2019

.

Сравнительный анализ хроматина в белой жировой ткани показывает, что люди могут иметь меньший потенциал побледнения, чем другие приматы

.

Genome Biol Evol

.

11

(

7

):

1997

2008

.

Викунья

л

, и другие.

2019

.

Адаптация к экстремальным условиям в смешанной человеческой популяции из пустыни Атакама

.

Genome Biol Evol

.

11

(

9

):

2468

2479

.

© Автор (ы) 2020. Опубликовано Oxford University Press от имени Общества молекулярной биологии и эволюции.

История

– Институт генетики человека в UCSF

Начало: 1960–1990 годы

1967

Исследования генетических основ человеческого развития, физиологии и наследственных заболеваний, а также уход за людьми с наследственными заболеваниями давно стали частью истории UCSF.Тем не менее, первой формальной организацией, посвященной генетике человека, было Отделение медицинской генетики, созданное в 1967 году на кафедре педиатрии Чарльзом Дж. Эпштейном. Медицинская генетика быстро превратилась в комплексную и высоко интегрированную службу, отвечающую практически за всю клиническую деятельность, обучение и исследования в области генетики и базирующуюся в отделениях педиатрии и акушерства, гинекологии и репродуктивных наук.

Члены этой группы сыграли важную роль в развитии многих областей медицинской генетики

Члены этой группы сыграли важную роль в развитии многих областей медицинской генетики – относительно новой области в конце 1960-х – начале 1970-х годов.Они добились больших успехов в пренатальной диагностике, что позволило улучшить генетическое консультирование и лечение генетических заболеваний. По мере создания формальной деятельности в области медицинской генетики в UCSF возник ряд сильных исследовательских и клинических групп, которые сосредоточились на широком спектре генетических заболеваний, начиная от артрита, астмы и сердечных заболеваний до рассеянного склероза, деменции, кожных заболеваний и рака. .

1970-е годы – ДНК и эпоха молекулярной генетики

Через несколько лет после создания клинической генетики в UCSF плодотворный вклад ученых UCSF привел к рождению технологии рекомбинантной ДНК и положил начало эре молекулярной генетики.Эти вклады изменили ландшафт генетики и заложили основу для новых клинических диагностик и методов лечения в ближайшие годы. UCSF стал мировым лидером в области молекулярной генетики, которым остается по сей день.

В 1973 году Херб Бойер и его коллеги открыли рестрикционный фермент EcoR1 и вместе с сотрудником Стэном Коэном из Стэнфорда изобрели клонирование ДНК, которое произвело революцию в фармацевтической промышленности и позволило впервые детально изучить и «исправить» гены человека.Дж. Майкл Бишоп и Гарольд Вармус были удостоены Нобелевской премии по физиологии и медицине 1989 г. за открытие онкогенов в 1976 г., что привело к пониманию того, что человеческий рак часто вызывается мутациями в нашей РНК.

В 1978 г. Кан и Андре Дози открыли первый полиморфизм в ДНК человека с помощью саузерн-блот-анализа, запустив возможность картировать гены на хромосомах человека.

В 1978 г. Кан и Андре Дози открыли первый полиморфизм в ДНК человека с помощью Саузерн-блот-анализа, запустив возможность картировать гены на хромосомах человека.В 1979 году Кан и Джуди Чанг использовали те же методы картирования генов, чтобы показать, как отсутствующие гены вызывают болезнь. Эта работа привела к разработке пренатального диагностического теста на β-талассемию, чрезвычайно распространенное и укорачивающее жизнь заболевание крови. Этот первый тест проложил путь пренатальному тестированию на множество других «региональных» мутаций. Д-р Кан был награжден премией Альберта Ласкера за клинические исследования 1991 года за его вклад в пренатальную диагностику.

С течением времени было разработано множество выдающихся программ в области микробной (бактериальной, вирусной, дрожжевой) генетики и различных областей модельной генетики организмов, включая такие разнообразные организмы, как дрозофилы, нематоды (C.elegans), рыбы-зебры и мыши. Медицинский институт Говарда Хьюза при UCSF также поддерживал исследования как в области генетики человека, так и в области генетики других организмов, а в Институте исследования рака была организована программа по генетике рака.

Дом: 1980-е – 1990-е годы

Высшее и медицинское образование

В связи с активизацией генетических исследований в UCSF была создана группа выпускников по генетике, которая предложила степень доктора философии по генетике в рамках Тетрадной программы Программы биологических наук (PIBS).Вторая учебная программа по генетике и геномике была учреждена в рамках программы для выпускников биомедицинских наук (BMS) с упором на исследования, связанные с заболеваниями. Третья программа обучения была разработана в Школе фармацевтики, в частности, в области фармацевтических наук и фармакогенетики (PSPG). Преподаватели IHG сыграли значительную роль в разработке учебных компонентов этих программ.

Программа по генетике человека и основной фонд геномики

В середине 1990-х годов в UCSF начал расти интерес к расширению деятельности в области генетики человека.

В середине 1990-х годов в UCSF начал расти интерес к расширению деятельности в области генетики человека

В 1997 году Медицинский факультет учредил Программу генетики человека. Эта программа, возглавляемая Чарльзом Эпштейном и Ирой Херсковиц, объединила ученых из разных дисциплин для выявления генов, вызывающих генетические заболевания, и, в конечном итоге, для прогнозирования, лечения и предотвращения их рецидивов. Программа легла в основу того, что сейчас является Институтом генетики человека, опираясь на прочную научную базу за счет набора персонала, благотворительности и космических обязательств для групповых исследователей генетики в кампусах Парнас и Миссион-Бэй, и обеспечивает непрерывный рост.

Параллельно с Программой в области генетики человека Ира Херсковиц и Чарльз Эпштейн создали Центр геномики, чтобы предоставить новейшие технологии секвенирования и генотипирования для поддержки и развития растущего генетического сообщества UCSF. Genomics Core Facility предоставляет полный спектр услуг в области геномики, от выделения ДНК до новейших технологий секвенирования и генотипирования. Совсем недавно, с помощью подарка от Фонда семьи Лэмонд, Институт инвестировал в новый высокопроизводительный вычислительный кластер, чтобы расширить аналитические услуги для всего экзома и данных последовательности всего генома.

Новое тысячелетие

Институт генетики человека

В 2001 году, в результате расширения UCSF до Mission Bay и появления новых площадей на Parnassus Heights, программа была намечена для дальнейшего развития. Институт генетики человека вырос из этой рекомендации с выделенными ресурсами для размещения, новыми должностями преподавателей и административной структурой.

Опыт доктора Риша в области математики, популяционной генетики, болезней человека и генетической эпидемиологии помог UCSF развить вычислительную геномику, ставшую возможным благодаря картированию генома человека и более широкодоступным технологиям генетического анализа.

После национальных поисков лидера 1 января 2005 года Нил Риш стал заслуженным профессором в области генетики человека Фонда семьи Ламонд и первым директором Центра генетики человека. Опыт доктора Риша в области математики, популяционной генетики, болезней человека и генетической эпидемиологии помог UCSF развить вычислительную геномику, ставшую возможным благодаря картированию генома человека и более широко доступным технологиям генетического анализа.

Благотворительные пожертвования от Фонда семьи Лэмонд предоставили спонсорскую должность профессора и исследовательскую стипендию, а также фонд новейших технологий для развития Основного фонда геномики.В октябре 2006 года Центр был создан как организованное исследовательское подразделение и стал Институтом генетики человека. С момента своего создания Институт стал одним из ведущих мировых центров исследований, образования и практики в области генетики человека.

В настоящее время институт включает более 70 преподавателей (3 заслуженных), занимающихся обширными исследованиями и клиническими интересами в различных пренатальных, педиатрических и взрослых условиях, а также в таких методологических областях, как эволюция человека и популяционная генетика, генетическая эпидемиология, компьютерная геномика. , молекулярные методы, функциональная геномика, фармакогенетика, принятие репродуктивных решений и биоэтика.Для получения дополнительной информации о нашем факультете, пожалуйста, посетите нашу страницу факультета. Помимо Парнаса и Миссион-Бэй, институт теперь охватывает все кампусы UCSF, Медицинский центр Сан-Франциско, штат Вирджиния, и Калифорнийский университет в Беркли. Мы гордимся нашими тесными исследовательскими связями с национальными лабораториями Лоуренса Беркли и отделом исследований Северной Калифорнии Kaiser Permanente.

Направления будущего

С начала 1970-х годов в области генетики UCSF наблюдаются бурные инновации, открытия и устойчивый прогресс по мере того, как мы продвигаемся вперед.Рост геномных и аналитических технологий, ставший возможным благодаря огромному количеству доступных сейчас геномных данных, гарантирует, что исследователи-генетики UCSF будут продолжать развивать исследования в области генетики человека, образование и уход за пациентами, поскольку мир вступает в новую революцию в генетических открытиях.

Краткая история генома человека

От первых клеток до зарождения нашего вида совершите вихревой тур через 3 миллиарда лет эволюции

Жизнь 12 сентября 2012 г.

Автор: Майкл Ле Пейдж

Обмен генов во время секса помогает организмам отсеивать плохие мутации от хороших

Laguna Design / Science Photo Library

GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATA GCGTATATTAAAGTTGCTGCAGTTAAAAAG

Это похоже на тарабарщину, но эта последовательность ДНК действительно примечательна.Он присутствует во всех клетках вашего тела, в вашей кошке или собаке, в рыбе на вашей тарелке, в пчелах и бабочках в вашем саду и в бактериях в вашем кишечнике. Фактически, где бы вы ни находили жизнь на Земле, от кипящих горячих отверстий глубоко под морем до замороженных бактерий в облаках высоко над планетой, вы найдете эту последовательность. Вы даже можете найти его в некоторых вещах, которые технически не живы, например, в гигантских вирусах, известных как мимивирусы.

Эта последовательность так широко распространена, потому что она возникла у общего предка всей жизни, и, поскольку она выполняет решающий процесс, с тех пор почти не изменилась.Другими словами, часть вашей ДНК – это невообразимо 3 миллиарда лет, переданная вам по неразрывной цепочке вашими триллионами предков.

Другие части вашей ДНК совершенно новые. В вашем геноме около 100 мутаций, которых нет у вашей матери или отца, от одно- или двухбуквенных изменений до потери или увеличения огромных фрагментов ДНК.

Мы можем сказать, какие части нашей ДНК старые или новые, сравнивая геномы. Например, сравнение вашего с таковыми вашего брата или сестры выявило бы совершенно новые мутации.Сопоставление геномов людей и животных обнаруживает гораздо более старые изменения.

«Некоторым из ваших ДНК невообразимо 3 миллиарда лет……

Век генетики человека | ДНК-отпечатки пальцев

Эта лекция сэра Алека Джеффриса была первоначально прочитана на 200-летии Лестерского медицинского общества в 2000 году и воспроизведена здесь с любезного разрешения сэра Питера Белла, бывшего президента Общества.

Век генетики человека: изучение вариаций и мутаций в геноме человека

Профессор сэр Алек Джеффрис, HonFRCP FRCPath FMedSci FLS FRS

Истоки

Генетику человека в ее современном понимании можно проследить до начала 20 века и всего от двух ключевых личностей.Первым был австрийский врач Карл Ландштейнер, который в 1900 году открыл систему групп крови ABO, первый пример изменчивой человеческой характеристики, унаследованной в соответствии с простыми правилами Менделя. Вторым был английский врач сэр Арчибальд Гаррод, чья работа в больнице Святого Варфоломея по наследственному заболеванию Алькаптонурия предоставила в 1902 году первый пример наследственного заболевания человека, которое аналогичным образом показало менделевскую наследственность.

Эти два открытия действительно определили два последующих великих направления исследований в области генетики человека, которые продолжаются и по сей день.Первый – это изучение нормальных генетических вариаций у людей, сначала по изменению группы крови, а затем по другим классам белков с использованием биохимических методов. Эти исследования предоставляют фундаментальную информацию о генетической изменчивости человеческого вида и о разнообразии человечества. Второй важной темой было понимание того, как наследственные дефекты наших хромосом могут вызывать наследственные заболевания. Однако оба подхода были сильно ограничены отсутствием большого количества генетических маркеров и полностью расцвели только после революции ДНК.

Расцвет геномики

Объявление структуры ДНК Ватсоном и Криком в 1953 г. ознаменовало начало молекулярной революции, которая продолжается до сих пор. Технология рекомбинантной ДНК, впервые разработанная в 1973 году, позволила манипулировать, анализировать и секвенировать сложные геномы. Первый человеческий ген был выделен в 1977 году, и сегодня у нас есть окончательный вариант всей последовательности человеческого генома, охватывающей большую часть из трех миллиардов пар оснований, составляющих человеческую книгу жизни.

Эта новая наука геномики, изучающая организацию генов и хромосом, однако, ничего не говорит нам о генетике, определяемой как изучение наследственной изменчивости. Геномные технологии оказались критически важными в изучении различий между людьми в наших точных последовательностях ДНК, и именно эта тема увлекала меня с тех пор, как я впервые переехал в Лестер в 1977 году.

Унаследованные вариации в ДНК человека

Еще в 1977 году единственными инструментами, которые у нас были для изучения изменчивости ДНК человека, были зонды, которые позволяли нам обнаруживать посредством гибридизации нуклеиновых кислот определенные области ДНК в хромосомах человека, и ферменты рестрикции, которые позволяли нам разрезать ДНК в заранее определенных местах.

Объединив эти два подхода, мы показали, что люди действительно демонстрируют вариации от человека к человеку в том, как рестрикционные ферменты разрезают свою ДНК, и что эти вариации в генетическом материале наследуются простым менделевским способом.

Эти так называемые полиморфизмы длины рестрикционных фрагментов позволили нам впервые оценить, насколько изменчивой была человеческая ДНК от человека к человеку; Ответ на молекулярном уровне был не очень велик: одна пара оснований из каждых трехсот показывала полиморфные вариации между людьми.Однако на уровне всего генома вариации были огромны: возможно, десять миллионов различных позиций в наших хромосомах показывали вариации.

Таким образом, проблема ограниченного числа генетических маркеров была решена, по крайней мере, в принципе. Недостатком было то, что эти однонуклеотидные полиморфизмы в то время было довольно трудно обнаружить и проанализировать, и в любом случае они были генетически не очень информативными.

Поэтому в начале 1980-х мы начали поиски гораздо большего числа вариабельных областей в человеческой ДНК, которые могли бы предоставить высокоинформативные маркеры для картирования человеческих хромосом.

Совершенно случайно мы наткнулись на один из первых примеров человеческого мини-сателлита, участок ДНК, состоящий из 30 или около того пар оснований, повторяющихся снова и снова десятки или сотни раз. Мало того, что некоторые из этих минисателлитов чрезвычайно различались у разных людей, причем вариации возникали из-за унаследованных различий в количестве повторов, они также, казалось, имели схожую последовательность ДНК.

Таким образом, мы пришли к выводу, что с помощью гибридизации нуклеиновых кислот можно одновременно обнаружить множество минисателлитов, используя этот общий мотив последовательности.Этот подход работал на удивление хорошо, не только отображая большое количество мини-спутников, но и впервые предоставив действительно индивидуальный образец ДНК человека. Так родился дактилоскопический анализ ДНК.

Судебно-медицинская экспертиза – неожиданная утечка

Было совершенно очевидно, что снятие отпечатков пальцев ДНК не только привело к появлению большого количества высокоинформативных генетических маркеров для медицинских генетических исследований, но и случайно решило другую серьезную проблему в генетике человека, а именно проблему биологической идентификации и установления семейных отношений в судебной медицине. и юридическая медицина.

Через несколько месяцев после разработки первого отпечатка ДНК мы применили этот подход к разрешению иммиграционного дела, а вскоре после этого и спора об отцовстве – первых дел подобного рода, когда-либо решаемых с использованием молекулярной генетики. Используя как дактилоскопию ДНК, так и более совершенную технологию профилирования ДНК, мы провели наше первое судебно-медицинское расследование в 1986 году по делу об убийстве Эндерби. Именно этот случай послужил толчком к применению молекулярной генетики в уголовных расследованиях по всему миру, а профилирование ДНК оставалось стандартной технологией вплоть до 1990-х годов.

Следующая революция произошла с развитием полимеразной цепной реакции (ПЦР), изобретенной Кэри Маллис, Генри Эрлихом и другими. Эта изящно элегантная и чувствительная технология позволяла многократно копировать мельчайшие количества ДНК в пробирку, позволяя усилить и типизировать следы биологических доказательств, обнаруженных, например, на месте преступления. Это также позволило разработать очень вариабельные маркеры, намного более короткие, чем мини-сателлиты, которые можно было легко усилить и типизировать.

Мы использовали эти короткие маркеры, называемые микросателлитами, в 1989 году при исследовании останков скелетов, эксгумированных из могилы в Бразилии и предположительно принадлежащих доктору Йозефу Менгеле, печально известному врачу концлагеря Освенцим. Сравнивая профили ДНК костей с живыми родственниками Менгеле, можно было установить, что останки действительно принадлежали военному преступнику, что позволило завершить крупное расследование, которое длилось десятилетия.

Впоследствии микросателлитное типирование было значительно усовершенствовано и в значительной степени автоматизировано, что позволило в 1995 году разработать в Великобритании первую национальную базу данных криминальной ДНК, которая в настоящее время содержит более двух миллионов профилей ДНК, в основном от осужденных преступников, но также и от нераскрытых дел.Эта база данных оказалась чрезвычайно эффективной при выявлении рецидивистов и установлении связей между различными нераскрытыми преступлениями.

Действительно, он оказался настолько успешным, что сейчас набирает силу возможность создания базы данных всего населения Великобритании. Такая глобальная база данных, несомненно, окажется чрезвычайно мощным инструментом в борьбе с преступностью, но при этом поднимает важные социальные, правовые и этические проблемы, которые еще не решены должным образом.

О происхождении вариации ДНК

Судебная экспертиза ДНК была в значительной степени решена, и мы обратили свое внимание на более фундаментальные проблемы вариаций ДНК человека, в частности, пытаясь понять механизмы, которые приводят к наследственным изменениям в нашей ДНК.

Здесь работают два ключевых процесса. Первый – это мутация, при которой спонтанные или, возможно, вызванные окружающей средой изменения в нашей ДНК устанавливаются и передаются последующим поколениям; К сожалению, мутации происходят в большей части нашей ДНК с такой низкой частотой, что их невозможно обнаружить в человеческих семьях.

Второй процесс – это рекомбинация или кроссинговер, при котором материнские и отцовские (гомологичные) хромосомы объединяются в пары в мейозе и обмениваются генетическим материалом перед разделением на отдельные сперматозоиды или яйцеклетки.Рекомбинация фундаментально важна для изменения паттернов вариаций в хромосомах человека, значительно увеличивая генетическое разнообразие человечества и подвергая новые комбинации генетических маркеров силам естественного отбора.

Опять же, наши знания о процессах рекомбинации в хромосомах человека сильно ограничены очень низкой скоростью на молекулярном уровне, с которой происходит этот процесс. Поэтому наша задача заключалась в разработке новых подходов к анализу мутаций и рекомбинации с очень высоким разрешением в попытке изучить эволюцию ДНК человека в реальном времени.

Миниспутники оказались отличной системой для развития этих технологий. Эти участки ДНК не только чрезвычайно вариабельны, но также могут мутировать (изменять количество повторов) с феноменальной скоростью, причем в некоторых случаях каждый десятый сперматозоид или яйцеклетка несет новую мутацию, по сравнению, возможно, с одним из миллиона. для мутации в обычных генах. Таким образом, можно увидеть, как мини-спутники мутируют в семьях.

Более того, можно использовать ПЦР для обнаружения новых мутаций непосредственно в ДНК сперматозоидов, что впервые дает возможность извлекать неограниченное количество мутантов зародышевой линии у любого подходящего человека.Кроме того, мы можем анализировать внутренние структуры минисателлитов очень подробно, и сравнивая структуры до и после мутации, мы показали, довольно неожиданно, что мутации минисателлитов на самом деле управляются процессом кроссинговера в мейозе; это показывает, что, по крайней мере, для этого класса ДНК, мутации и рекомбинация не являются разными и отдельными процессами.

В большинстве случаев минисателлиты мутируют копиями (аллелями) при спаривании гомологичных хромосом, после чего информация копируется и переносится с одного аллеля на другой, что приводит к рекомбинантному мутанту, но без кроссовера как такового.Однако, используя новые очень мощные методы отдельных сперматозоидов, стало возможным изучать истинные кроссоверы с очень высоким разрешением.

Это показало, что мини-спутники расположены на границах интенсивных пересекающихся горячих точек, при этом текущие данные свидетельствуют о том, что именно эти горячие точки вызывают нестабильность на мини-спутниках, а не наоборот. Это, в свою очередь, предполагает, что мини-спутники являются паразитами в горячих точках, которым удалось задействовать механизм рекомбинации для собственного распространения.

Обнаружение горячих точек кроссовера возле мини-спутников поднимает серьезные вопросы о распределении событий кроссовера по хромосомам человека, которое долгое время считалось довольно случайным. Чтобы понять, являются ли эти «горячие точки» правилами, а не исключениями в человеческих хромосомах, мы недавно начали анализ области в главном комплексе гистосовместимости, гигантском комплексе генов, тесно связанных с функцией иммунной системы.

Эта область давно изучается в семьях, в частности, в отношении сопоставления тканей при трансплантационной хирургии, и эти семейные исследования предоставили предварительные доказательства того, что кроссоверы могут быть значительно неслучайно распределены в этой области генома человека.Поэтому мы использовали анализ спермы с очень высоким разрешением, чтобы начать анализ молекулярного распределения кроссоверов в этой области.

Все имеющиеся на сегодняшний день данные свидетельствуют о том, что узко локализованные горячие точки, связанные с мини-спутниками, не являются исключением в геноме человека, а, напротив, являются правилом. Это, в свою очередь, означает, что кроссоверы в хромосомах человека жестко регулируются, что приводит к сильной кластеризации в сильно локализованные области интенсивной активности.

Сейчас мы распространяем эти открытия на другие части генома человека, а также пытаемся понять правила, которые определяют, почему существуют горячие точки и как они распределяются в хромосомах человека.Это не просто академический поиск; кластеризация кроссоверов в «горячие точки» существенно повлияет на способ распределения вариаций по хромосомам человека, что окажет серьезное влияние на поиск генов, участвующих в наследственных заболеваниях человека.

Мутагенез в окружающей среде

Давно известно, что такие факторы окружающей среды, как ионизирующее излучение, могут вызывать наследственные мутации в ДНК экспериментальных организмов. Удивительно, но нет никаких доказательств существования такого явления в человеческих популяциях, например, у людей, подвергшихся облучению после атомных бомб в Хиросиме и Нагасаки.

Проблема заключается в очень низкой частоте мутаций, связанных с традиционными системами мониторинга зародышевой линии, которые требуют мониторинга сотен тысяч или даже миллионов семей, чтобы иметь возможность обнаруживать индуцированные наследственные мутации. Поэтому мой коллега доктор Юрий Дуброва и я использовали крайне нестабильные мини-спутники в качестве нового подхода к мониторингу мутаций, в частности, чтобы увидеть, реагируют ли они на факторы окружающей среды, такие как ионизирующее излучение.

Эксперименты по облучению, конечно, очень трудно проводить на людях.Поэтому мы сосредоточили наше внимание на группах населения, случайно подвергшихся радиоактивному облучению. В крупном исследовании чернобыльской катастрофы мы показали, что у населения Беларуси, проживающего в загрязненных регионах, наблюдается необычно высокий уровень мутаций у своих детей, который, по-видимому, коррелирует со степенью радиоактивных осадков в их окружающей среде.

Это первое прямое свидетельство радиационно-индуцированной наследственной мутации у человека, но к нему следует относиться с большой осторожностью, поскольку могут быть и другие мешающие факторы окружающей среды, ответственные за изменение частоты мутаций.

Тем не менее, д-р Дуброва наблюдала подобное явление у населения, подвергшегося воздействию радиоактивных осадков в окрестностях советского испытательного полигона ядерного оружия в Семипалатинске в бывшем Советском Союзе в Казахстане. Два исследования ликвидаторов Чернобыля, людей, посланных для очистки электростанции после катастрофы, дали противоречивые результаты: одно показывает доказательства появления радиационно-индуцированных мутантов в их потомках, а другое не дает никаких результатов.

Аналогичным образом, исследования мутаций мини-сателлитов у выживших после атомной бомбардировки японцев и их семей не показали никаких доказательств радиационно-индуцированной мутации, равно как и никаких доказательств радиационно-индуцирующей мутации сперматозоидов у мужчин, подвергающихся лучевой терапии нижних отделов брюшной полости.Ясно, что требуется гораздо больше работы, чтобы увидеть, действительно ли человеческие мини-спутники реагируют на излучение таким замечательным образом, как повторяющиеся ДНК у мышей. Если подтверждена радиационно-индуцированная мутация у людей, то она явно имеет большое значение как для понимания взаимодействия между радиоактивностью и зародышевой линией, так и для радиобиологической защиты.

Будущее

После того, как последовательность генома человека в значительной степени завершена, генетика человека готова быстро двигаться в двух основных направлениях.

Во-первых, функциональная геномика, а именно попытка понять функции десятков тысяч генов, присутствующих в наших хромосомах. Вторая задача – получить гораздо более глобальную картину разнообразия в геноме человека и использовать ее для понимания нашего эволюционного происхождения и начать анализировать многочисленные и разнообразные процессы мутации, рекомбинации и естественного отбора, которые приводят к изменчивости в человеческих популяциях.

В последнем отношении мы сделали первые несколько шагов, используя мини-спутники в качестве модельных систем.Задача на будущее состоит в том, чтобы распространить эту работу на другие классы более редких, но потенциально более биологически значимых наследственных мутаций.

Наконец, я хотел бы поблагодарить всех моих коллег как из моей исследовательской группы, так и из отдела генетики в Университете Лестера, а также многих других друзей как внутри, так и за пределами Университета, которые внесли огромный вклад во все наши исследования.

Оставить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *